This report is dedicated to those mighty goats who fight valiantly for the freedom to speak their mind. & Second Edition 1. IMMUNE exp e ————Á—Ó 4 2S ERE ВВА Масата ооло tere een sgn ancora eae 22 3. ЅҮМРТОМ5 .................... дДҙҘҙә1 М... аннан 26 4. РАВАЅІТЕС......... РИ... анаа КТ 30 ЖАаНПҺ4--- ЖҰРТ OM оо, , МЕТ 60 6. THE МОВКЕНФ, ЕЛ M 0 А .522.).......................................... 89 7. THE DRONES.............. ДЧ E ЛЫСЫ ененин 132 8. THE QUEEN Ы ҚЫН аа ОКК ........... 140 9. TRUTH AS НЕНОЙ eno OO Oe ИЛ ао a oaaao aooe: 148 10. КА МАМА КАА ІЛ/ЕВАМА............2. емле йа ме ымен sensen немене setot nenat 153 11 DEWORMING а 157 12 TREATMENTS н. 165 par-a-site [pere sit] %) NOUN 1. anorganism that lives in or on an organism of another species (its host) and benefits by deriving nutrients at the other's expense: "the parasite attaches itself to the mouths of fishes" - [more] Taxonomic range [edit] Parasitism has an extremely wide taxonomic range, including animals, plants, fungi, protozoans, bacteria, and уігиѕеѕ 155 Head DNA Ш | Collar Protein Tail Long Tail Fibres 2D 3D Tapeworm Base Plate 1. IMMUNE SYSTEM Cats have a schedule for routine treatment of parasites. Dogs have a schedule for routine treatment of parasites. Horses have a schedule for routine treatment of parasites. Cattle have a schedule for routine treatment of parasites. Chickens have a schedule for routine treatment of parasites. All mammals that interact with humans have a schedule for routine treatment of parasites. Except for one... Are you a mammal? Do you interact with humans? When was the last time you were prescribed a schedule for a routine treatment of parasites? The immune system of all mammals naturally fights off parasites. Yet, all mammals [except one] are still given a schedule for routine treatment of parasites. But how does the human immune system compare with the immune system of other mammals? Reconcile. Is Vitamin C necessary for a healthy immune system? Which is the only mammal incapable of producing its own Vitamin C? What is 'hypoascorbemia'? If humans cannot naturally produce Vitamin C, would humans be more susceptible to parasite infection than any other mammal? If humans are more susceptible to parasite infection than all other mammals, then why are humans the only mammal which is not given a schedule for routine treatment of parasites? Logical thinking. № Female “=e Egg-mass Does Vitamin C deficiency result in depression, schizophrenia, Alzheimer’s disease, gastrointestinal disease, fatigue, death, and even cancer? Preventive and Therapeutic Potential of Vitamin C in... https://pubmed.ncbi.nlm.nih.gov/30074145 In the past few decades, scientists have revealed that the deficiency of vitamin C may lead to motor deficit, cognitive impairment and aberrant behaviors, whereas supplement of vitamin C has a potential preventive and therapeutic effect on mental illness, such as major depressive disorder (MDD), schizophrenia, anxiety and Alzheimer's disease (AD) Author: Qian-Qian Han, Tian-Tian Shen, Fan Publish Year: 2018 Do these symptoms result from a vitamin deficiently, or are these symptoms resulting from parasites rapidly multiplying in a host with an immune system weakened from vitamin deficiency? What is the [real] cause of depression, schizophrenia, Alzheimer's disease, gastrointestinal disease, fatigue, death, and cancer? It gets worse. What is Teetotalism? Why is alcohol so fervently pushed upon society? Does alcohol prevent the body's absorption of Vitamin C? @ sciencedaily.com/releases/2016/05/160512085348.htm Chronic drinking interferes with absorption of critical vita- mins by pancreas Date: May 12, 2016 Source: American Physiological Society (APS) Summary: Chronic exposure to alcohol interferes with the pancreas’ ability to absorb vitamin C, po- tentially predisposing the body to pancreatitis and other pancreatic diseases, a new study reports. The findings provide a link between chronic alcohol use and poor pancre- atic health. Does it damage the blood-brain barrier making the brain susceptible to parasitic infection? pubmed.ncbi.nim.nih.gov/33799986/ Alcohol-Induced Blood-Brain Barrier Impairment: An In Vitro Study Donatello Carrino 1, Jacopo Junio Valerio Branca 1, Matteo Becatti 2, Ferdinando Paternostro ! Gabriele Morucci 3, Massimo Gulisano 1, Lorenzo Di Cesare Mannelli ^, Alessandra Pacini ! Affiliations + expand PMID: 33799986 PMCID: PMC7967408 DOI: 10.3390/ijerph18052683 Free PMC article Abstract In recent years, alcohol abuse has dramatically grown with deleterious consequence for people's health and, in turn, for health care costs. it has been demonstrated, in humans and animals, that alcohol intoxication induces neuroinflammation and neurodegeneration thus leading to brain impairments. Furthermore, it has been shown that (BBB), but the molecular mechanisms underlining this detrimental effect have not been fully elucidated. For this reason, in this study we investigated the effects of alcohol exposure on a rat If a mammal is unable to produce its own Vitamin C, and if that mammal is given a substance which prevents the body's absorption of Vitamin C, will that mammal suffer from a dramatically compromised immune system? Would parasites thrive in such a host? What is the [real] purpose for promoting alcohol consumption? It gets worse. Is the sugar industry highly subsidized? Do parasites require a continually high diet of sugar? More specifically: do parasites rely on aerobic glycolysis? G @ ncbi.nlm.nih.gov/pmc/articles/PMC3989997/ TRENDS IN PARASITOLOGY ELSEVIER | $ REE Full-Text Article 7 Trends Parasitol. 2014 Apr; 30(4): 170-175. PMCID: PMC3989997 doi: 10.1016/j.pt.2014.02.001 PMID: 24636355 The proliferating cell hypothesis: a metabolic framework for Plasmodium growth and development” 1,2 J. Enrique Salcedo-Sora,1:* Eva Caamano-Gutierrez, Stephen A. Ward, and Giancarlo А. Biagini' > Author information + Copyright and License information Disclaimer This article has been cited by other articles in PMC. Abstract Go to: Ў We hypothesise that intraerythrocytic malaria parasite metabolism is not merely fulfilling the need for ATP generation, but is evolved to support rapid proliferation, similar to that seen in other rapidly proliferating cells such as cancer cells. Deregulated glycolytic activity coupled with impaired mitochondrial metabolism is a metabolic strategy to generate glycolytic intermediates essential for rapid biomass generation for schizogony. Further, we discuss the possibility that Plasmodium metabolism is not only a functional consequence of the ‘hard-wired’ genome and argue that metabolism may also have a causal role in triggering the cascade of events that leads to developmental stage transitions. This hypothesis offers a framework to rationalise the observations of 20/5 2/49/27 atypical mitochondrial metabolism, and metabolic switching in nonproliferating stages. Are parasites incapable of surviving on fats? Did the sugar industry pay to trick us into thinking that fat was the cause of ill health? LINK Did this deceptive tactic dramatically reduce fat consumption while also increasing sugar consumption? If fats protect against parasites and sugars promote them, what effect would removing fats and adding sugars have on the parasites infecting human hosts? What is the [real] purpose of sugar subsidies? It gets worse. Is promiscuity shamelessly pushed upon society? Cuckolding can be positive for some| couples, study says СЕ) How I Told Му Husband and Boyfriend I'm Dating Another Man 1 already had a husband, a boyfriend, and all the guys I could fuck. ! had enough guys. Then there was Conor. MORE VICE Isn't Actually’ That Bad Top Gaining Categories аќ Cuckold 472: Japanese 46 Indian 457 Cosplay 444 Korean 459 Transgender Creampie Gangbang French Cartoon Taught One Man The Couple | Open Relationships | мелік | xo Be. e Ip m Can parasites be sexually transmitted? LINK1 LINK2 ISN'T ACTUALLY THAT BAD DAILY BEAST со Ga... [The case for being a cuck. Cuckolding: The Sex Fetish for Intellectuals Why Being Called a Cuck Is Actually a Compliment You should sleep with at LEAST 25 guys before settling down, and I'll tell you exactly why Cuckold tattoos are the latest trend for the modern man @ 006-00: Why and How I've Cheated On Every Person I've Ever Dated Why I Can't Stop Cheating ө The New York Times © Opinion: Western men’s sperm counts are falling, and we ought to be concerned. The Middle East can help. ia 00000 Micro-cheating on my partner was the best thing ever How to Keep à Backup SO in Case You Get Dumped = Here Is Why A Husband Gives His Wife Encouragement To Be An Adulteress % ap g Ove 567 #Cuckolding is a favorite among relationships. e vice He gets so much enjoyment кот my body - my boobs sre huge— but he cant perform the same way as someone with, | INST: We Asked Couples Why They Opened Up Their Relationship Man Says Letting His Wife Sleep Around Helped Him. ‘Get’ Feminism Polyamorous Woman Says The Key To A Successful The New Yorker @ o= f adulterer Marriage Is Having Multiple Partners Woman goes on dates with мала and both na put done work? Yes, being against cuckoldin is low-key kinda racist INSIDE THE WORLD OF CUCKOLDING: A Se CUCKOLD EXPLAINS ALL а= Mail Online "It's engrossingly erotic’: Research shows the number of men who want to see their partner have sex with others doubles in a decade Can an open marriage EVER work? After 10 years and two children, one woman reveals what happened when she told her husband she wanted to sleep with other men FEZIZEN Gs A photographer who took pictures with people she met on Tinder and pretended to love revealed a lot about true intimacy WATCHING YOUR PARTNER HAVE CAN BE GOOD marie daire SUBSCRIBE FAR-LEFT VOTERS MORE LIKELY TO SHARE WINGERS MORE THEIR WIVES, RIGHT I Cheated on My Boyfriend pea ТУ with My Rapist By seducing my assaulter, | was reclaiming the control I'd lost over my body and identity. [5 3 re Nous sommes | PRÊTS! I've cheated on every guy I've ever dated, and | don't feel even a little bit sorry Ш pubmed.ncbi.nlm.nih.gov/29211102/ Can sexual transmission support the enzootic cycle of Trypanosoma cruzi? Adriano Rios ', Marcelle Ribeiro !, Alessandro Sousa !, Fernando Pimentel ', Luciana Hagström ', Rafael Andrade 1, Rozeneide М Alves 1, Ana de Cassia Rosa !, Antônio RI Teixeira 1, Nadjar Nitz 1 Mariana M Hecht ! Affiliations + expand PMID: 29211102 PMCID: PMC5719536 DOI: 10.1590/0074-02760170025 Free PMC article Abstract Background: Trypanosoma cruzi circulates in sylvatic habitats, mainly through blood-feeding triatomines, although other routes also contribute to its dispersion. Sexual transmission of T. cruzi is an understudied topic, especially among wild mammals. Because of the difficulties inherent to field work, experimentally infected mice are frequently used to evaluate the transmission of T. cruzi. Objective: This study aimed to evaluate the sexual transmission of T. cruzi in acutely infected mice. Methods: Male and female mice in the acute phase of Chagas disease were mated with naive partners. Then, parasitological tests, mmunohistochemistry, serological assays, and polymerase chain reaction (PCR) assays were used to detect infection. Findings: Parasitological analysis showed trypomastigotes in the blood of 2096 of the naive mice after mating with infected partners. Serological assays detected anti-T. cruzi antibodies in all naive females mated with infected males and in 6096 of naive males mated with infected females. PCR showed T. cruzi nDNA bands for all naive mice mated with infected partners. The possibility of sexual transmission was also confirmed by visualisation of amastigotes in the testes. Main conclusions: Our results demonstrate that ЭТЕ a ea tr E EE T HT s that may contribute to maintenance of the parasite's enzootic cycle. & ncbi.nlm.nih.gov/pmc/articles/PMC582 Evidence for Previously Unidentified Sexual Transmission of Protozoan Parasites Clara Crespillo-Andujar, ' Marta D az-Menéndez 2 and Marta Mora-Rillo к Author information + Copyright and License information Disclaimer Abstract Goto: » Knowing the mode of transmission of a disease can affect its control and prevention. Here, we identify 5 protozoan parasites with demonstrated presence in seminal fluid, only 1 of which has been identified as a sexually transmitted disease among humans. Spaghetti How many different types of parasites exist? Helminths, which are large organisms you can see with the naked eye. There are nearly 50,000 different helminth species including flatworms and roundworms. Flatworms include flukes and tapeworms. Roundworms include pinworms, which are the most common helminth intestinal parasite in the United States. Protozoa, which are one-celled, microscopic organisms. There are over 10,000 different protozoa species. In the United States, the most common ones include Giardia lamblia, Entamoeba histolytica, Cryptosporidium, and Cyclospora cayetanensis. If there are over 60,000 different parasites listed in just two categories, how many more must exist if all kinds of parasites are considered? If all of these parasites can be transmitted between individuals through close, intimate contact, why are only 18 of them listed on medical sites as STDs? Bacterial STDs Syphilis Chlamydia >) Chancroid » Gonorrhea Lymphogranuloma venereum Would increased sexual promiscuity result in an increase of infected hosts? Non-gonococcal urethritis Non-specific genital infection Viral STDs Historically, what was the purpose of 'You may now kiss the bride’? Hepatitis B ё betterhealth.vic.gov.au/health/conditionsandtreatments/kissing-and-your-health HPV Viruses that can be transmitted by kissing >) Genital warts Examples of illnesses caused by viruses that can be transmitted during kissing include Colds - also known as upper respiratory tract infections. Many different viruses can cause the common cold. Colds are thought to be spread by direct contact with the virus. You could catch the cold from airborne droplets or by direct contact with secretions (fluids and mucous) from the infected person’s nose and throat Glandular fever — also known as the kissing disease. Glandular fever is the common term for a viral infection called infectious Ж mononucleosis, caused by the Epstein-Barr virus. The virus is spread through saliva and infection occurs through contact ОБ анада Herpes infection — viruses that аге considered рагі of the herpes family include Epstein-Barr, varicella-zoster (causes chickenpox) and herpes simplex (causes cold sores). Herpes simplex virus can be spread through direct contact with the virus when kissing Herpes is most easily spread to others when the blisters are forming or have erupted. The virus can be ‘shed’ (spread to others) from the site of blisters even when they have healed. Chickenpox is easily spread from person to person by direct contact, droplets or airborne spread Candidiasis (Moniliasis) Parasitic Hepatitis B — kissing may also transmit this virus, although blood has higher levels of this virus than saliva. Infection can occur when infected blood and saliva come into direct contact with someone else’s bloodstream or mucous membranes. (Mucous membranes line various body cavities including the mouth and nose.) A person is more likely to be infected when kissing if they have open sores in or around the mouth ulosis pubic Pedic » Trichomoniasis Warts - warts in the mouth can be spread through kissing, especially if there are areas of recent trauma It gets worse. 10 Is plastic rare or everywhere? Is it now found on top of mountains? Does it blanket the Artic? Does it accumulate inside of our bodies? Microplastics in the Arctic and the Alps may have blown in on the wind 09000000 ENVIRONMENT 14 August 2019 By New Scientist and Press Association Do parasites associate well with plastic? @ nature.com/articles, 22-10485-5 Апісіе | Open Access | Published: 26 April 2022 Association of zoonotic protozoan parasites with microplastics in seawater and implications for human and wildlife health Emma Zhang, Minji Kim, Lezlie Rueda, Chelsea Rochman, Elizabeth VanWormer, James Moore & Karen Shapiro) Scientific Reports 12, Article number: 6532 (2022) | Cite this article 5247 Accesses | 1 Citations | 965 Altmetric | Metrics Abstract Plastics are widely recognized as a pervasive marine pollutant. Microplastics have been garnering increasing attention due to reports documenting their ingestion by animals, including those intended for human consumption. Their accumulation in the marine food chain may also pose a threat to wildlife that consume species that can accumulate қ 5 2 В " "NP 1 Micropiastics found in the Alps are carried on the wind and brought to the ground with snow microplastic particles. Microplastic contamination in marine ecosystems has thus raised Werner L h/Gcet concerns for both human and wildlife health. Our study addresses an unexplored area of Tiny particles of plastic have been found in h parts of Germany and the Arctic, even places as remote as the island of Svalbard and in snow on drifting ice floes. These microplastics may have drifted there on wind currents. igh concentrations in snow samples from the Swiss Alps, research targeting the interaction between plastic and pathogen pollution of coastal waters. We investigated the association of the zoonotic protozoan parasites Toxoplasma gondii, Cryptosporidium parvum, and Giardia enterica with polyethylene microbeads and polyester microfibers. These pathogens were chosen because they have been recognized by the World га! a pnas.or о Health Organization as underestimated causes of illness from shellfish consumption, and due to their persistence in the marine environment. We show that 719199 еее in contaminated seawater, with more parasites adhering to microfiber surfaces as compared with microbeads. Given the global presence of microplastics © Janice Brahney, © Natalie Mahowald, (9 Marje ... rs m in fish and shellfish, this study demonstrates a novel pathway by which anthropogenic See all authors and affiliations pollutants may be mediating pathogen transmission in the marine environment, with PNAS April 20, 2021 118 (16) e2020719118; https://doi.org/10.1073/pnas.2020719118 important ramifications for wildlife and human health. Edge) environmental Health Perspectives Q Edited by Akkihebbal R. Ravishankara, Colorado State University, Fort Collins, CO, and approved February 16, 2021 (received for review October 8, 2020) Info & Metrics D PDF —————-————-———-g--—--— Microplastics on Human Kidney Proximal Tubular Epithelial Cells HK-2 and Male C57BL/6 Mice Yung-Li Wang, Yu-Hsuan Lee, Yung-Ho Hsu, United States of plastic It's raining plastic: l-Jen Chiu, Cathy Chia-Yu Huang, Chih-Chia Huang, microscopic fibers fall Significa Zi-Chun Chia, Chung-Pei Lee, Yuh-Feng Lin, and 5 Мамет ены from the sky in Rocky Microplastic particles and fibers generated Mountains Published: 6 Мау 2021 CID: 057003 https://doi.org/10.1289/EHP7612 from the breakdown of mismanaged waste are now so prevalent that they cycle through Discovery raises new questions about the amount of plastic waste permeating the air, water, and soil virtually everywhere on Earth the earth in a manner akin to global B About = Sections * PDF ВА < biogeochemical cyclesgin modeling the Abstract show that most atmospheric plastics are Background: Understanding the epidemic of derived from the legacy production of plastics chronic kidney disease of uncertain etiology may be from waste that has continued to build up in critical for health policies and public health А . responses. Recent studies have shown that the environment. Roads dominated the micropl св (MPs) contaminate our food chain and p = sources of microplastics to the western accumulate in the gut, liver, kidney, muscle, and so on. Humans manufacture many plastics-related : A United States, followed by marine, agriculture, рго ts. Previous studies have indicated that 2 particles of these products have several effectson | «< It gets worse. 11 and dust emissions generated downwind of Why is our drinking water fluoridated? Does fluoride damage the immune system? What is fluorosis? Would this increase parasite infection? & ncbi.nlm.nih.gov/pmc/articles/PMC2956113/ It has been described that application of sodium fluoride (NaF) as the main fluoride source to cells under culture can induce an excess of p53, a protein expressed when there is damage to the DNA [7]. On the other hand, induction of apoptosis has been described in the epithelial cells of human lung cultured with growing amounts of NaF, as well as general changes in alveolar macrophages under culture [8.9]. Additionally, it has been described that incorporation of fluoride in the diet of animals under experimentation can cause liver damage expressed as induction in the expression of caspases (that are the last effectors of apoptosis), as well as of the protein bcl-2 (the protein activated during apoptosis) [10,11]. Conversely, it has been reported that in geographic zones where fluorosis 1s endemic, there 1s an increase in the presence of bacterial, viral, and Parasitic infections in humans or in wild or farm animals that have been intoxicated with this type of compound when it is present in drinking water in concentrations exceeding the maximal dose recommended by the World Health Organization (WHO), which is <1 parts per million (ppm) of NaF [1.2]. In Mexico, acute and chronic fluorosis is present mainly in central-northern states in which the water presents NaF concentrations that exceed WHO health norms [1]. The presence of NaF in aquifers is very important because this compound 1s not filtered by the conventional water purification systems that are employed precisely to prepare water for human consumption [1—6]. Also, NaF dissolved in water has neither taste nor smell: thus, people can ingest great quantities of this toxin without being aware of it [1,6]. Once consumed, NaF can cause alterations in systems such as digestive, nervous, reproductive, and immunological [1.12]. As mentioned previously, individuals who present fluorosis are more susceptible to presenting bacterial, viral, and parasitic infections, which indicates that there can be a change in their immune system, in which leukocytes play a very important role as defense systems against these infections [1]. From another viewpoint, it is known that a in p blood circulation à have completed Тқ =< life have demonstrated that leukocytes incubated in the presence of NaF | present an increase in the expression of proteins p53 and bcl-2, which are considered markers of the presence of apoptosis [1,4-8] and which would indicate that this toxin can promote this type of phenomena in systems іл vivo. ... presence of NaF in aquifers is very important because this compound is not filtered by the conventional water purification systems that are employed to prepare water for human consumption .. for human consumption Flavor» f e, ..human consumption 4,7. ride (is i Fluorosis >>> Immunocompromised >>> Hosts more susceptible to parasites Why do they [really] fluoridate our drinking water? It gets worse. 12 Why is there such a large push for bug protein and cockroach milk? [Lvetve|] = =} MARKETS BUSINESS INVESTING TECH POLITICS CNBC TV INVESTING CLUB @ PRI Drink up: Cockroach milk is the protein drink you didn't know you've been missing By Susan Sculti, CNN FOOD & BEVERAGE How entrepreneurs are persuading Americans to eat bug protein PUBLISHED FRI, FEB 14 2020.1:42 PM EST Jane Wells Fahiemah Al-Ali suas f W in Wa 8JANEWELLS STHISFAHIEMAH Updated 10:22 AM EDT, Wed July 27, 2016 Will eating edible insects spread parasites? Q @ pubmed.ncbi.nim.nih.gov/33108441/ Edible Insects and Toxoplasma gondii: Is It Something We Need To Be Concerned About? Maurizio Percipalle 1 2, Antonio Salvaggio 13 Giovanni M Pitari ê, Renato P Giunta 1 5, 1 Alessandra Араго 1, Tiziana Alfonzetti 1, Anna Maria Fausta Marino ! 6 Affiliations + expand PMID: 33108441 DOI: 10.4315/JFP-20-239 Abstract Abstract: Novel foods, such as edible insects and food products on the basis of insects, could play an important role in both human and animal nutrition in the future. The identification of dangers associated with insect consumption is fundamental to guarantee consumer safety and adequate regulatory guidelines for operators of the food sector. Although former studies have focused on the microbiological contamination of fresh or processed edible insects, so far little information is available about the occurrence of foodborne parasites, such as Toxoplasma gondii, whose life cycles make them candidates for potential insect breeding substrate contamination. Hence, we investigated the presence of contaminating T. gondii in farmed edible insects to rule out this further hazard for consumers. Four species of insects most commonly used as food for human consumption were analyzed: mealworm; African migratory locust, house cricket, and silkworm. Samples included live specimens but also minimally (dehydrated) and highly processed edible insects. рМА ууеге детестеді іп ватріе5 оҒ 4деһуагағейі теаімогпт These results highlight the need for implementing good farming and processing practices with particular care paid to safe storage and handling of feed and substrates used for edible insects to reduce the chance of T. gondii entering the human food chain. Пп ё pubmed.ncbi.nim.nih.gov/31283777/ A parasitological evaluation of edible insects and their role in the transmission of parasitic diseases to humans and animals their parts. One of the most commonly used species of insects are: mealworms (Tenebrio molitor), house crickets (Acheta domesticus), cockroaches (Blattodea) and migratory locusts (Locusta migrans). What is the [real] reason why they want to use insects as a food source? In this context, the unfathomable issue is the role of edible insects in transmitting parasitic diseases that can cause significant losses in their breeding and may pose a threat to humans and animals. The aim of this study was to identify and evaluate the developmental forms of parasites colonizing edible insects in household farms and pet stores in Central Europe and to determine the potential risk of parasitic infections for humans and animals. The experimental material comprised samples of live insects (imagines) from 300 household farms and pet stores, including 75 mealworm farms, 75 house cricket farms, 75 Madagascar hissing cockroach farms and 75 migrating locust farms. Parasites were detected in 244 (81.33%) out of 300 (100%) examined insect farms. In 206 (68.67%) of the cases, the identified parasites were pathogenic for insects only; in 106 (35.33%) cases, parasites were potentially parasitic for animals; апа іп 91 (30.3326) Cases, parasites were potentially pathogenic for humans§ 13 It gets worse. What is the purpose of vaccines? Are excipients, such as polysorbate-80 placed into vaccines? & sciencedirect.com/science/article/pii/0378517389902664 International Journal of Pharmaceutics Volume 57, Issue 1, 15 December 1989, Pages 77-83 ELSEVIER The effect of polysorbate 80 on brain uptake and analgesic effect of D-kyotorphin Toshiyasu Sakane *, Chihiro Tanaka :, Akira Yamamoto +, Mitsuru Hashida >, Hitoshi Sezaki 2,1, Hiroshi Ueda 2, Hiroshi Takagi? Show more v https://doi.org/10.1016/0378-5173(89)90266-4 Get rights and content Abstract The effect of the non-ionic surfactant, polysorbate 80, on the blood-brain barrier was investigated by using an in situ brain perfusion technique. It was confirmed that the brain perfusion technique allowed quantitative measurement of the cerebrovascular transport of drugs with varying degrees of lipophilicity and D- glucose. A linear relation was obtained between cerebrovascular PA products of drugs and their octanol/water partition coefficients. Transport of D-glucose, which is known to be a carrier-mediated process, was observed to be concentration- dependent and the Ky, Vmax and Қа values could be obtained by non-lineara least- squares regression. It was shown in perfusion experiments that the intravascular volume calculated from [**C]inulin was increased significantly by intravenous administration of polysorbate 80. The content of D-kyotorphin also showed a tendency to increase. These effects of polysorbate 80 were also confirmed by the analgesic effect of D-kyotorphin in mice in vivo. D-Kyotorphin at 300 mg/kg showed no analgesic activity whereas it did display a significant level following administration with polysorbate 80. These results suggested that polysorbate 80 @ nature.com/articles/srep31578 affected the blood-brain barrier and enhanced the brain uptake and analgesic activity of D-kyotorphin. Abstract adjuvants remain the most widely used and effective adjuvants in vaccination and immunotherapy. Herein, the particle size Are adjuvants, such as aluminum, placed into vaccines? distribution (PSD) of aluminium oxyhydroxide and aluminium hydroxyphosphate adjuvants was elucidated in attempt to correlate these properties with the biological responses observed post By temporarily distracting the immune system with the vaccination. Heightened solubility and potentially the generation of Al* adjuvant, is the immune system less capable of reacting to other threats? What is reactogenicity? Could this cause a rapid increase in parasitic infection? in the lysosomal environment were positively correlated with an increase in cell mortality in vitro, potentially generating a greater inflammatory response at the site of simulated injection. The cellular uptake of aluminium based adjuvants (ABAs) used in clinically approved vaccinations are compared to a commonly used experimental ABA, in an in vitro THP-1 cell model. Using lumogallion as a direct-fluorescent molecular probe for aluminium, complemented with transmission Do these excipients and adjuvants help intra-bodily ob- jects cross the blood-brain barrier? electron microscopy provides further insight into the morphology of internalised particulates, driven by the physicochemical variations of the ABAs investigated. We demonstrate that not all aluminium adjuvants are equal neither in terms of their physical properties nor their Are parasites intra-bodily objects? biological reactivity and potential toxicities both at the injection site and beyond. High loading of aluminium oxyhydroxide in the cytoplasm of THP-1 cells without immediate cytotoxicity might predispose this form of aluminium adjuvant to its subsequent transport throughout the body including access to the brain. Are adjuvants and excipients placed into vaccines to help parasites gain access to human brains? 14 Are parasites an infectious disease? Diseases Declined 90% To prevent disease, should we focus on more BEFORE Vaccines Were introduced injections or on access to clean water? Mane * i Due to Sanitation and Clean Water Systems Whooping Cough / Pertussis Diphtheria 3 А А Vaccine Historically, which was more successful? Death Rate 88885884858 Measles Scarlet Fever Death Rate 882888588 8882883858 © Kolten Parker © Mi GkolenParker [ v Fonon | Typhoid Fever Black water coming out of taps in Crystal City as 5 city officials are under fed indictment mysanantonio.com/news/local/art... 1:27 PM - 19 Feb 2016 - [3 No widespread Vaccine vaccination Death Rate Death Rate "usus о „5 @ theguardian.com/environment/2016/jan/16/flints-water-crisis-what-went-wrong Flint's water crisis: what went wrong If clean water is so effective at preventing disease, then reconcile the following: After the water supply was found to contain high levels of lead, evidence is mounting that officials ignored or neglected indicators 1. Amount of money spent on water ofa growing crisis treatment facilities 2. Amount of money spent on develop- ing patentable vaccines What is the [real] purpose of vaccines? It gets worse. Lee and Ernie Perez knew something was amiss when their three cats started throwing up after drinking water. What are heavy metals? Do parasites associate well with heavy metals? Is aluminum a heavy metal? Is aluminum sprayed over major metropolitan areas to "prevent global warming by reflecting sunlight"? Is cadmium a heavy metal? Did the US government admit to spraying ZnCdS over 29 urban and rural areas in the US and Canada? LINK Do these heavy metal particles eventually fall to earth where they enter the body through respiration? What other ways might heavy metals, like aluminum, enter the body? Is there a way for heavy metals to bypass the body's natural filtration system? Aluminum in vaccines Aluminum is used in vaccines as an adjuvant. An adjuvant is vaccine component that boosts the immune response to the vaccine. Adjuvants allow for lesser quantities of the vaccine and fewer doses. The adjuvant effects of aluminum were discovered in 1926. Aluminum adjuvants are used in vaccines such as hepatitis A, hepatitis B, diphtheria-tetanus-containing vaccines, Haemophilus influenzae type b, and pneumococcal vaccines, but they are not used in the live, viral vaccines, such as measles, mumps, rubella, varicella and rotavirus. Previous studies have linked frequent exposure to high levels of aluminum to adverse health effects on the central or peripheral nervous system or both), Alzheimer's disease, and breast cancer. Jan 15, 2020 www.medicalnewstoday.com » articles How can we reduce our exposure to potentially harmful ... Eye Worm Nose Worm е с @ cell.com/parasitology/comments/S0169-4758(98)01358-1 Are dormant parasites activated by the presence of heavy metals? о Trends in Parasitology REVIEWS ME 15, ISSUE 1, P16 ANUAR Parasites as Accumulation Indicators of Heavy Metal Pollution В. Sures • К. Siddall « H. Taraschewski e B. Sures R. Siddall > H. Taraschewski DOI: https-//doi.org/10.1016/50169-4758(98)01358-1 ~ PlumX Metrics What is the [real] reason for Abstract putting heavy metals into our ў Parasites are attracting increasing interest from parasite ecologists as potential bodies? indicators of environmental quality because of the variety of ways in which they respond to anthropogenic pollution. However, until recently, little was known about the accumulation of toxins within parasites. Certain parasites, particularly intestinal acanthocephalans and cestodes of fish, can accumulate heavy metals at concentrations that are orders of magnitude higher than those in the host tissues or the environment. In this review, Bernd Sures, Roy Siddall and Horst Taraschewski discuss the recently It gets worse. described phenomenon of conspicuous metal accumulation by parasites and how this might be applied to environmental monitoring. They also suggest how environmental science and parasitology might profit from each other in the near future. In contrast, does Fenbendazole eliminate parasites without side-effects? 15 Fenbendazole successful in removing parasites from any mammal? Can it even successfully remove parasites from non-mammals, such as reptiles and fish? ШЕ ecommons.luc.edu/cgi/viewcontent.cgi?article=4366&context=luc_theses 1985 Survey of Intestinal Parasites in Zoo Populations of Two Central Illinois Zoos and Study of Current Anti-Parasitic Drugs and Prophylactic Techniques Verona A. Barr Loyola University Chicago Fenbendazole has also been tested on reptiles. Holt and Lawrence (1982) used fenbendazole in the treatment of 82 reptiles. They found fenbendazole to be effective against single and mixed infections of ascarids, oxyurids and strongyloides in 84.1% of the reptiles treated. А11 of the snakes were given a single dose while the tortoises were given two doses separated by a three week interval. No deaths or side effects were observed in the test group. In general, the literature has shown that fenbendazole is apparently free of side effects. H N NHCOOCH, All without side effects. 15 Fenbendazole safe for use in humans? LINK EUROPEAN MEDICINES AGENCY SCIENCE MEDICINES HEALTH 15 January 2014 EMA/42178/2014 Veterinary Medicines Division Committee for Medicinal Products for Veterinary Use (CVMP) CVMP assessment report for Panacur AquaSol (EMEA/V/C/002008/X/0003) International non-proprietary name: fenbendazole Assessment report as adopted by the CVMP with all information of a commercially confidential nature deleted. Toxicological studies Single dose toxicity Oral single dose studies in mice, rats, rabbits and dogs demonstrate that fenbendazole is of low acute toxicity. The study results did not allow the derivation of no-observed-adverse-effect levels (NOAELs). Repeat dose toxicity Data on repeat dose toxicity are available from rats and dogs. The overall NOAEL was 4 mg/kg bw/day, based on lymphoid hyperplasia observed in dogs. Tolerance in the target species of animal Please refer to Part 4. No points of concern relevant for the safety of fenbendazole in humans could be identified. 18 If Fenbendazole has no side effects and is safe for human consumption, why was an extensive study funded to determine how long ‘animals used for human consumption’ must be weaned off of Fenbendazole in order to ensure the removal of Fenbendazole from the animal before slaughter? EUROPEAN MEDICINES AGENCY SCIENCE MEDICINES HEALTH 15 January 2014 EMA/42178/2014 Veterinary Medicines Division Committee for Medicinal Products for Veterinary Use (CVMP) CVMP assessment report for Panacur AquaSol (EMEA/V/C/002008/X/0003) International non-proprietary name: fenbendazole Assessment report as adopted by the CVMP with all information of a commercially confidential nature deleted. Withdrawal periods Based on the provided residue depletion study in tissues a Withdrawal period of 6 days for edible) tissues can be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for chicken when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for 5 consecutive days. The withdrawal period for slaughter is calculated using the alternative approach by taking the first time point where all concentrations are below the respective MRL (72 hours for liver, 96 hours for muscle and 120 hours for kidney and skin+fat) and adding a safety span of 20%, resulting in a withdrawal period of 4 days for liver, 5 days for muscle and 6 days for kidney and skin+fat. Overall withdrawal period for slaughter: 6 days. Based on the provided residue depletion study in eggs a withdrawal period of zero days for eggs can be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for chicken when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for 5 consecutive days. As at all-time points residue levels were below MRL (though above LOQ), the withdrawal period is calculated by estimating the 95% tolerance limit for each time point (safe concentration per milking (SCPM) method for milk). The 9596 tolerance limits for all time points were below MRL. Withdrawal period for eggs: zero days. 19 Ivermectin Equine Wormer is only approved by the FDA for use in horses only. This product is NOT approved for human consumption. Compare this treatment of Fenbendazole to the treatment of Glyphosate. Does Glyphosate cause terrible damage to the cells inside the human digestive tract? Does this ‘damaged human digestive tract’ result in the digestive tract inefficiently absorbing vitamins and minerals required for a strong immune system? Is Glyphosate sprayed directly onto crops used for human consumption? Is Glyphosate sprayed onto crops immediately before harvest, resulting in Glyphosate absorbing into food meant for human consumption? Would spraying Glyphosate onto ‘food meant for human consumption’ compromise the immune system of any human who ate that food? Does compromising the human immune system benefit parasites inside human hosts? LINK Compare and contrast: Fenbendazole harms parasites inside humans. Glyphosate helps parasites inside humans. Fenbendazole is illegal in food meant for human consumption. Glyphosate is legally authorized in food meant for human consumption. Reconcile. It gets worse. 20 If Fenbendazole has no side effects and is safe for human consumption, why is Fenbendazole labeled ‘not for human consumption’? If Fenbendazole has no side effects and is safe for human consumption, why require that Fenbendazole not be used in animals meant for human consumption? “For other areas in the world, retreatment periods for the migrating larvae of S. vulgaris may be different; consult with your veterinarian. CAUTIONS: Keep this and all medication out of the reach of children. When using Panacur® (fenben- dazole) Paste 10% concomi- tantly with trichlorfon, refer to the manufacturer’s labels for use and cautions for trichlorfon. DOSAGE: Panacur® (fenbendazole) Paste 10% is administered orally at a rate of 2.3 mg/Ib (5 mg/kg) for the control of large strongyles, small strongyles, and pinworms. One syringe will deworm a 1,100 Ib horse. For foals and weanlings (less than 18 months of age) where ascarids are a common problem, the recommended dose is 4.6 mg/b (10 mg/kg); one syringe will deworm a 550 Ib horse. Let us review: Fact: Despite there existing a recommended parasite schedule for every other species which comes into direct contact with humans, there exists no recommended parasite treatment schedules for humans. Fact: It has been made illegal to treat humans with the most effective methods for treating parasites. Fact: All parasite medications are intentionally prevented from entering food meant for human consumption. All of this results in a system where humans are forced to rely entirely upon their immune system to combat parasites. However... Fact: Humans have a naturally weak immune system due to their inability to produce Vitamin C. Fact: The human immune system has been intentionally weakened through a variety of external methods: 1. Fluoride added to our water 2. Heavy Metals added to our air 3. Glyphosate added to our food 4. Adjuvants added to our vaccines 5. Alcohol pushed in mainstream media 6. Microplastics added to environment Fact: The spread of parasites is intentionally encouraged in variety of ways: 1. Sugars added to our food 2. Infected insects used as food 3. Addictive psychiatric drugs prescribed by doctors 4. Promiscuity pushed in mainstream media 5. Fenbendazole removed from our food X9,000 — 2um Healthy Immune Function Taken together, these things turn the human body into the perfect parasite-breeding ground. Due to lifestyle choices, environmental factors and genetic factors, humans are systemically much more susceptible to parasitic infection than any other mammal. So why do all other mammals have recommended parasite-treatment schedules and humans do not? Logical thinking. The answer is worse than you can imagine. 21 2. THE BRAIN Why do parasites need access to human brains? @ INDEPENDENT SPORT Can the parasite gain control over the host by accessing the central nervous system? "Lombie' deer disease could spread to humans, experts warn NEWS POUTICS VOICES CULTURE INOY UFE INDYBEST voto DAILY EDITION ‘It’s possible the number of human cases will be substantial and will not be isolated events’ @JournoJane | Monday 18 February Can parasites lobotomize their host and turn them into living zombies? People who eat deer meat could be at risk of contracting a deadly infectious disease that is spreading across the animals’ US populations, experts have warned. LINK Chronic wasting disease (CWD) -dubbed “zombie” deer disease - has infected deer. elk and moose across 24 American states and two Canadian provinces. The disease attacks tissues including the brain} and spinal cord, causing dramatic weight loss, loss of coordination, listlessness, drooling, excessive @ sciencedaily.com/releases/2019 Science News thirst or urination and intense aggression before the animal dies. ‘Flying salt shakers of death:' Fungal-infected 'zombie' cicadas June 25, 2019 & theconversation.com/the-crab-castrating-parasite-that-zombifies-its-prey-27200 The crab-castrating parasite that zombifies its prey West Virginia University West Virginia University researchers have discovered that a cicada fungus called Massopora contains chemicals similar to those found in hallucinogenic mushrooms = : ex THA "m 9 Meet Sacculina carcini - а barnacle that makes a living as a real-life body-snatcher The fungus causes cicadas to lose their limbs and eccentric be- of crabs. Unlike most barnacles that are happy to simply stick themselves to a rock havior sets in: Males try to mate with everything they encounter. al- and filter food from the water, Sacculina and its kin have evolved to be parasitic, and they are horrifyingly good at it. though the fungus has consumed their genitals and butts. Despite the horrid physical state of infected cicadas, they continue The microscopic larva of Sacculina seeks out an unsuspecting crab using to roam around freely as if nothing's wrong, dousing other cicadas with a dose of their disease specialised sensory organs. It then settles on a part of the crab where its armours is most vulnerable, usually on the membrane at the base of one of the crab’s hair А (called a setae). You've heard of "The Walking Dead." This is "The Flying Dead." "They are only zombies in the sense that ШЕПТЕ Кеете Eod said Matt Kasson, assistant professor of forest pathology and one of the study's authors The larvae then transforms itself into a kind of living hypodermic syringe (called a kentrogon). This syringe stabs the base of the crab's hair and injects the next stage of the parasite - a microscopic blob called the vermigon - into the crab's bloodstream. This blob will eventually grow into a parasite та 1107591175 rab's entire body. Why lobotomize the host? Sacculina (аке оует (һе һові іп Бойһ Боду апа тіпа it castrates the crab, then turns it into a doting babysitter that grooms and aerates the barnacle’s brood, tending the next generation of baby-snatchers as if they were its own babies. Lest Does the lobotomy allow pa rasites to force you think Sacculina is alone in its nightmarish ways, it is just one genus in an the host to spread the infection to new entire order of barnacles called Rhizocephala (the “root head”). hosts? In estuaries around the world, tiny trematode worms take over the bodies of aquatic snails. These parasitic flatworms invade the snails’ bodies and use them to support the worm colony, sometimes for more than a decade, "CYW. ТЕТТЕ " according to Ryan Hechinger, a scientist at California's Scripps Institution of Oceanography 22 What happens when parasites enter the brain of a human host? Can the brain be damaged to influence human behavior? Can the brain be damaged to limit human cognitive abilities? What are NPCs? NPC Do humans have a second brain? What is the Enteric nervous system? LINK Where are parasites most commonly found? Can parasites residing in the gut influence behavior? What are ‘Gut Instincts’? What is the subconscious? Can the subconscious be manipulated? Can parasites manipulate the subconscious to change human personality? @ newscientist.com/gallery/mg20327161300-enemy-within-human-parasites mper NewScientist News Podcasts Video Technology Space Physics Health More » Shop Tours Events Jo The enemy within: 10 human parasites Why influence host personality? 60000 Why influence host behavior? 9 July 2009 Symbiotic relationships between a parasite and a host can have beneficial еНесе even changing | тт енна and evolution. Often, however, the damage outweighs the positives. New Scientist investigates some of the most common human parasites and the damaging effects they can have The end goal of a parasite is not to kill the host, but to spread more parasites to more hosts. It gets worse. Reminder: Are parasites sexually transmitted? Reminder: Can parasites change the host’s personality? Why might the following behavior seem so prevalent? | just finished up living with a guy that was cheating on his girlfriend and he thought it was funny. Also expected me to share in the laugh. | could write several volumes on that cocksucking demon. H] | know the type all too well. It's like meeting Agent Smith. They are all the same personality. Sick and twisted but in exactly the same way. Dumb as all shit too. Unable to create anything new. They have no original thoughts. 2118 ! Г How many people did you sleep with in college? 40 comments share save hide report crosspost j by: best w RainbowCrocs Let's see. 3 a week. 50 weeks in a year. 200 weeks in 4 years. So around 600. permalink embed save give award NU 2 UnnamedNamesake Never kept count. But over 200. permalink embed save give award 9 kimininegaiwo I would never tell my boyfriend this, but more than 100. А А А болтын ombud өне чаны The infected engage іп promiscuous ons behavior to spread the parasite. I wrote down all their names in a spreadsheet. And the magic number is.....ding, ding, ding... permalink embed save give award of Venne1139 ' The infected create a promiscuous I was the Pi Kappa Alpha Dream Girl so a lot of frat guys. Probably around 100. society to spread the pa rasite permalink embed save give award tessanicoleS 50 FIV. If you include giving oral then more than 400, permalink embed save give award Hollywood told us we would fight man-eating zombies during the apocalypse. But it is something much more subtle, much more alluring, and far, far more frightening: They are sex zombies. 24 Why does every major civilization collapse when it allows promiscuity? Do parasites use sexual promiscuity to turn citizens into zombies? Do the infected sex zombies then tear down their own civilization? If you want to destroy any nation without war, make adultery or nudity British ethnologist and social anthropologist at Oxford Mai and Cambridge University, Joseph Daniel Unwin MC (1895 - 1936) conducted a massive study of 6 major civilizations and 80 lesser societies covering 5.000 years of history. He set out his study expecting to find evidence supporting Sigmund Freud's theory that civilizations are essentially neurotic and coe themselves by restricting sex too much. But to Unwin's surprise, a the evidence he discovered pointed exactly to opposite conclusions. common in the young generation. Saladin чү - жі In his exhaustive examination of sexual behavior and their affect upon society, Unwin observed that monogamous : ; А cultures prosper and those disinclined to restrain.sex to What is the Bacchanalian Conspiracy? monogamous marriage remain primitive or, if once Did it lead to extreme Roman degeneracy? successful, they decline. Did women rule over it? әлігі Unw in Wor Why did it involve violence and sodomy? T and Culture Seanad Охо University Press, 1934); Why did homosexuality become the norm? Sexual Regulations and Cultural Behavior (London: Oxford University Press, 1935) A э Hopousia: Or the Sexual and Economic Foundations of a New Society (London: Why did Rome [really] collapse: George Allen and Unwin, 1940). “Under cover of religion, priests and acolytes broke civil, moral and religious laws with impunity. Young girls and youths were seduced, and all modesty was set aside. Every kind of vice found its full satisfaction. But crimes did not remain confined to these meetings. False witnesses, forgeries, false wills and denunciations proceeded from this focus of crime. Poisoning and assassination were carried on under the cover of the Bacchanalians.” Does any of this sound familiar? "Unwin's conclusions, which are based upon ап enormous wealth of carefully sifted evidence, тау be summed up as follows. All human societies are in one or another of six cultural conditions: zoistic, manistic, deistic, rationalistic, expansive, productive. Of these societies the zoistic displays the least amount of mental and social energy, the productive the most. Investigation shows that the societies exhibiting the least amount of energy are those where pre-nuptial continence is not imposed and where the opportunities for sexual indulgence after. marriage are greatest. The cultural condition of-a society rises in exact proportion as it imposes рге: nuptial and post-nuptial restraints upon sexual opportunity.” It gets worse. 25 3. SYMPTOMS Tami А : ЕР Are you infected with parasites: July 15, 2016 at 9:30 PM How would you know? Should you get tested? Is testing even effective? LINK NK Thad 4 stool tests to date, one by the lab my Doctor ordered at the lab he uses and 3 from me going to emergency rooms. All tests with negative results. But my stool samples were full of parasites as they are every bowel movement and very visible. I have had them for no less than 5 years. I feel like I’m fighting for my life and the Doctors are letting me die by ignoring what is so obvious to see. I have taken in bottles of my stool watered down with living, moving parasites at the bottom of the bottle, certain that i could finally convince someone to do something to get rid of them before they kill me. I have recognized no less than 5 different parasites by breaking down my stool in water until I can see the parasites. jinga uo can see them and still will not prescribe medication Бесаиѕе е 1а геѕиїёѕ соте Баск перануе There's something wrong with that picture, Anonymous (ID: 6527270) = 08/26/22(Fri)23:17:45 No.392742108 » >>392742262 22392740841 The doctor likely had zero education on parasites. Life cycles, vectors etc. 22392741217 | unintentionally fasted when | got very sick with ? for 3 weeks and couldn't hold anything down. They migrated out of my alimentary system. | explained it up thread. | went to a ENT. It got very ugly between us. She accused me of DL images from Internet. VERY expensive bullshittery. My breast cancer friend | spoke about was telling her neighbor about my nose worms. The neighbor thinks--hey maybe that's what's wrong with me. So buys one of those pump type neti pots. First go sucks out a mess of worms, Panics, rushes with container to doctor...who refused to send them to the lab, and gave her 1 pill. Try getting a fecal float test from a doctor. One lady dropped a LIVE one on top of her 'sample" and the test results came back NOPE--you don't have parasites. She documented it all with pics. Including the live one on top of her "sample". Dr. Klinghardt discusses parasite detection: Unfortunately, there are no reliable lab tests to rule out parasites, especially those that stray from the gut into the central nervous system. Insiders estimate the detection rate to be less than 196. So out of a hundred people who һауе parasites, [lab tests will show a positive result] in one. Every parasitologist knows this, but they are not allowed to talk about it. As a clinician | have to say, there are way more people being made ill by parasites than the lab work can show right now. [3] signs of parasites Important Video: LINK anxiety / brain fog/ depression weak memory How ever, to have parasites, it c etc And boom, y stomach : : infections problems Instead of looking for a root problem on diseases adhd, and have to dea h the medicines side е Look for parasites in you, it might be the root problem to your depression, over eating, mental fogginess. Etc | was raised in MX, so this is a commonly recommended tion on families dark circles under eyes иш ssues headache They actually have a ton of commercials about it The Red Cross used to administer dewormers at the sc problems THEY KNOW--my mom told me that when they were growing up they were lined up in the garage once a month and treated with kerosene or turpentine (both are or were pure pine oils) then given a hefty dose of castor oil. They were no more dirty etc than modern life is, in fact likely cleaner. They wouldn't allow dogs/cats in the house 7doggo goes out for morning shit, sniffs around yard, rolls in raccoon shit or sniffs, eats it >runs back in house jumps in bed with baby and licks it's face Raccoons carry FLUKES, fluke eggs stick to fur, rover licks fur, your face, and sprinkles the parasite by products..everywhere | watched on "van life couple" take their cat to the vet when it shat out parasites on their bed. | was like..what about you? What about baby? What about---nope--just the cat got treated. 26 Are you infected? Does your poo float? Do you have body odor? Common food sources of parasite infection: LINK Do you get headaches? Anonymous (ID: ERZI) L+] 04/06/22(Wed) 11:48:18 No.371469040 » Do you have addictions? >>371455554 | was addicted to weed and coca cola, magically stopped being addicted after doing a deworming procedure similar to yours. And my shit stopped floating, would just sink to the bottom of the toilet. >>371458800 I've been pretty clear minded since, just take probiotics ог eat something that will replenish the biome. Q ё pubmed.ncbinlm.nih.gov/1730397 Not that hard. > Am J Ther. 2007 Jan-Feb;14(1):63-105. doi: 10.1097/01.mjt.0000208 272.42379 Recurrent headache as the main symptom of acquired cerebral toxoplasmosis in nonhuman immunodeficiency virus-infected subjects with no lymphadenopathy: the parasite may be responsible for the neurogenic inflammation postulated as а cause of different types of headaches Joseph Prandota ! Affiliations + expand PMID: 17303977 DOI: 10.1097/01.mjt.0000208272.42379.aa Abstract Headache and/or migraine, a common problem in pediatrics and internal medicine, affect about 5% to 10% children and adolescents, and nearly 30% of middle-aged women. ШЕСІ P P 03 most common clinical manifestations of acquired Toxoplasma gondii infectiong 4 ие system (CNS) in immunosuppressed subjects. Common Symptoms of Parasites in Humans i Constipation. Gas or bloating. Diarrhea. Pains or aches in the back, joints or muscles. Irritable bowel syndrome. Allergies. Increased appetite. Itchy ears, nose or anus. Nervousness or grumpiness. Chronic fatigue, lethargy or apathy. Various skin problems. Tooth grinding or clenching. Anemia. Excess weight. Forgetfulness. = Vision problems. zs Problems sleeping. Do you have allergies? LINK Do you has asthma? LINK Do you have diabetes? LINK Did you answer 'yes' to any of these questions? 27 Do you eat fruits or vegetables? Do you eat meat? Do you drink tap water? Do you shower with tap water? Have you ever used a public restroom? Do you pick your nose? Have you ever had a cold? Have you had more than one sex-partner? Has your sex-partner been with anyone else? Are your pets allowed inside the house? Your pets Or do you have no symptoms at all? "You can have a person riddled with infection who never realized there's a 2-centimeter-long worm in their eye and thousands of parasites in their blood,” Dillman said. "The immune system never signaled something was wrong. How is that possible? We know very little about how that works.” Dillman is focused specifically on the proteins that nematode spit releases into hosts during an infection. "Venom also describes this accurately,’ Dillman said. & naturalnursemomma @naturalnursemom The CDC says that only 14% of the US population has been exposed to parasites. But that isn't anywhere near the reality of it. Conventional medicine all but ignores them because most tests do not pick them up. Increasing food allergies, anxiety, insomnia are all linked to 2 ©. Parasites are arguably the most common cause of health issues today. The amount of symptoms caused by them are endless as they impact structural, chemical, and emotional functions. This is a reason why they are ignored by medicine, most believe a digestive symptom must be present However, on top of GI symptoms, parasites are linked to teeth grinding, insomnia, anxiety, depression, seizures, skin issues, allergies, fatigue, chronic pain, anemia, itchy butt, add/adhd, bed wetting and night terrors to name a few. Science News from research organizations Memory, Depression, Insomnia - - And Worms? : August 5, 2008 Oklahoma Medical Research Foundation Researchers have spent decades probing the causes of depression, schizophrenia and insomnia in humans. But a new study may have uncovered key insights into the origins of these and other conditions by examining a most unlikely research sub- Research article | Open Access | Associations of mental disorders and neurotropic parasitic diseases: a meta- analysis in developing and emerging countries Labanté Outcha Daré ©, Pierre-Emile Bruand, ..Pierre-Marie Preux + Show authors BMC Public Health 19, Article number: 1645 (2019) | Cite this article 1.Parasites contribute to fatigue by feeding on iron. They steal your iron stores causing clinical or subclinical anemia which equates to low oxygenation of your tissues. This manifests as fatigue. 2.Parasites contain many serotonin receptors. This means they also steal your serotonin which is the hormone that when low relates to anxiety/ depression & insomnia. This is also why symptoms near the full moon are often due to parasites because serotonin levels are increased. 3.Parasites also shift the immune system into a TH2 pattern which elevates IgE and mast cells in the body. This equates to allergies of all kinds including food and environmental. Skin issues like hives and rashes also result from this TH2 shift. | The role of parasites and pathogens in influencing generalised anxiety and predation-related fear in the mammalian central nervous system Maya Kaushik et al. Horm Behav. 2012 Aug. (Intestinal parasites and lactose malabsorption] [Article in French] D Gendrel et al. Arch Fr Pediatr. 1990 Oct. Show details x Abstract Breath-test was performed for diagnosis of lactose malabsorption in 50 Gabonese children of normal nutritional status, aged 5 to 15 years, with parasites in stools, but without diarrhoea or digestive symptoms. Control group was unparasitized and 28 naturalnursemomma Here's the thing about this issue... you go to your regular provider and they say okay let's run a stool test. It's called an ova and parasite (O&P) ... but it's negative every time. At the very least, they need to repeat x3. BUT testing for parasites is elusive... and what is worse? Testing for Lyme, mold can be elusive too.. these things like to hide in parasites. As well, with a chronic gut infection from parasites you will also have immune suppression increasing the likelihood of constant sickness. Symptoms of parasites might look like the things mentioned in the slides, but it also might look like weight loss resistance or a lot of weight loss, allergies, fatigue, micronutrient deficiencies, rashes, inflammation, autoimmune activation. It might look like insomnia in children, frequent leg cramps, increasing food sensitivities, hyperactivity or mood changes...See that's the thing, as @drcharliedc_2.0 was saying, parasites cause symptoms in every single body system. We WILL be discussing solutions... first steps should always be opening drainage pathways. Making sure having daily && @. sweating, sunshine, deep breathing, etc. more on this to come. One more crucial aspect of parasites is their ability to protect and harbor in toxins like Lyme, EBV and mold. If you are detoxing from any of those and not taking into consideration parasites, you may be playing a tug of war battle with them which can make it impossible to heal. Rope Worms: LINK1 LINK2 VIDEO CHAPTER III Tue VALUE or А Lire Tuere is a certain class of people in the South known as "poor whites," noted for their shiftlessness and indolence. These are all native-born Americans. Many of their ancestors were of Anglo-Saxon stock, which has been called “the flower of the race.” Why have they degenerated into this condition of indolence, shiftlessness, and poverty? A few years ago the cause was dis- blood of its victim. It takes away from a person all desire and ability to work and makes him “ feel tired all the time.” 3 Besides afflicting two million people with a dreadful chronic disease and slaughtering thousands of children, this tiny parasite has, it is estimated, cost the South several hundred million dollars by retarding the devel- opment of agriculture and industry. And yet, amazing as the statement may seem, every victim of hookworm disease may be completely cured at a cost of only sixty cents each, and the disease may be entirely prevented by the most simple precautions. Some one has put it in this way: “If you owned a machine that ought to earn $300 a year and it was covered, and it was found to be chiefly a matter of ill health. A tiny One cause parasite, less than half an inch of shift long and no thicker than a piece '***"*** of sewing thread, was the cause of all the trouble. This little Aookworm has earning only $100 and you could restore the proper earning power by an expenditure of sixty cents, could there be a better investment for your money ?” A sixteen-year old boy was so weakened by hook- worm disease that he was scarcely able to do two days work a weck. He was treated, and the hookworms expelled from his body. During the next five weeks he gained seventeen and a half pounds in weight while he was working six days cach week. This is only one striking example of the needless waste of human life that is going on in the United States. How THE ноок- WORM DEVELOPS. 1-7, segmentation of the egg; 8-16, the embryo; 11, the worm escap- been called “the vampire of the South," ing from the because it sucks the lifeblood of the people. As we have learned, it burrows shell; 12-13, empty shells through the skin, finds its way to the intestines, hooks itself on to the intestinal wall, and slowly drains the Newly Discovered Rope Worm Infections: First Case Report in Gulf Cooperation Council Countries Ali Sher”, Saif A. Latif? lInfectious Diseases Hospital Laboratories, Ministry of Health, Kuwait City, Kuwait. 2North Khaitan Clinic, Ministry of Health, Kuwait City, Kuwait. DOI: 10.4236/oalib.1108196 PDF HTML XML 28 Downloads 5,017 Views Abstract Rope worms are anaerobic worms that were discovered in 2009 during the cleansing of the colon by coffee or cleansing enemas. They are rope-like meter-long intestinal parasites and look like twisted fibres of rope attached to the intestinal wall. Thousands of people have passed the rope worms in their stool all over the world. Aim: This study aimed to find the cause of intestinal blockage by the worm passing in stool, identify them and treat the patient. Morphology: The rope worms look like a rope and slimy in nature and over a meter long. They were identified in five different developmental Worm1 stages based on their morphology. Clinical Symptoms: The rope worm produces a slimy sticky Wo rm2 substance with a distinct odour, twists like a corkscrew, and may obstruct the intestine. It may also Worm3 cause abdominal pain, bloating, gases, indigestion, and constipation. Conclusion: The patients were Worm4 Never touch them Really never touch them treated several times in the area clinic with anthelminthic drugs with no improvement of symptoms. The patients were unable to pass the stool without water or milk rectal enemas. 4. PARASITES Do parasites cause symptoms of depression? LINK HEALTH Over 50% Of Liberal, White Women Under 30 Have A Mental Health Issue. Are We Worried Yet? BY ELIZABETH CONDRA Define Mental Illness. Apr 13th 2021+ (0) 7 min read Are antidepressants designed to treat the symptoms of depression or to cure the patient of depression? Which would be better for the patient? Which would be better for the drug manufacturer? Why do anti-depression medications not work in long-term studies? LINK Do human emotions stem from chemicals secreted by glands in the human body? Do parasites feed on the chemical secretions from these glands? Would parasitic infection cause a chemical imbalance leading to depression and other mental illnesses? Do antidepressants cause an artificial increase to these chemicals? Would this result in a ‘return to normalcy’? [temporary] Would the artificial increase of these chemical secretions [food source for parasite] result in an increase to the number of parasites in the host? Would this ‘increase in parasites’ once again deplete the body of the chemicals needed for mental well-being? Would this require an increased dosage in medication to ‘return to normalcy’? Would this increased dosage cause an even greater increase in parasites? Why do anti-depression medications [really] not work in the long-term? Define Addiction. j — - It gets worse. а 30 Can parasites cause neurological disorders? Metabolomic signature of mouse cerebral cortex following Toxoplasma gondii infection Jun Ma, Jun-Jun He, Jun-Ling Hou, Chun-Xue Zhou, Fu-Kai Zhang, Hany M. Elsheikha ©) & Xing-Quan Zhu Parasites & Vectors 12, Article number: 373 (2019) | Cite this article 1401 Accesses | 7 Citations | 1 Altmetric | Metrics Abstract Background The protozoan parasite Toxoplasma gondii infects and alters the neurotransmission in cerebral cortex and other brain regions, leading to neurobehavioral and neuropathologic changes in humans and animals. However, the molecules that contribute to these changes remain largely unknown. @ sciencealert.com/mind-altering-parasite-transmitted-by-cats-linked-to-several-brain-disorders Mind-Altering Cat Parasite Just Go Linked to A Whole Lot of Neurological Disorders HEALTH 14September 2017 By PETER DOCKRILL Can parasites cause anxiety? The role of parasites and pathogens in influencing generalised anxiety and predation- related fear in the mammalian central nervous system Alain Pham/Unsplash Maya Kaushik, Poppy H.L. Lamberton, Joanne P. Webster 3, & The brain-dwelling parasite Toxoplasma gondiiis estimated to be hosted by at least 2 billion people around the world, and new evidence suggests the lodger could be more dangerous than we think. Show more v + AddtoMendeley 33 Cite While the protozoan invader poses the greatest risk to developing foetuses infected in the womb, new research suggests the parasite could alter and amplify a range of neurological disorders, including epilepsy, Alzheimer's, and Parkinson's, and also cancer. https://doi.org/10.1016/j.yhbeh.2012.04.002 Get rights and со Abstract This article is part of a Special Issue “Neuroendocrine-Immune Axis in Health and Disease.” Behavioural and neurophysiological traits and responses associated with anxiety and predation-related fear have been well documented in rodent models. Certain parasites and pathogens which rely on predation for transmission appear able to manipulate these, often innate, traits to increase the likelihood of their life-cycle being completed. This can occur through a range of mechanisms, such as alteration of hormonal and neurotransmitter communication and/or direct interference with the neurons and brain regions that mediate behavioural expression. Whilst some post-infection behavioural changes may reflect ‘general sickness’ or a pathological by-product of infection, others may have a specific adaptive advantage to the parasite and be indicative of active manipulation of host behaviour. Here we review the key mechanisms by which anxiety and predation-related fears are controlled in mammals, before exploring evidence for how some infectious agents may manipulate these mechanisms. The protozoan Toxoplasma gondii, the causative agent | just learned toxoplasmosis exists and | have a cat so | Googeled it. Google images was kind enough to put my mind at ease with this gem. 31 Can parasites eat brain tissue? Naegleria Fowleri cases are being reported throughout certain regions of the United States Credit: Alamy What is brain-eating amoeba? Naegleria fowleri, commonly referred to as the "brain-eating amoeba," is a free-living microscopic amoeba that can cause a devastating brain disease. The parasite enters through the nose and into the brain where it turns into Primary Amebic Meningoencephalitis (PAM), which is a disease of the central nervous system. If parasites eat brain tissue, could parasites be the cause of Alzheimer's Disease? Could Toxoplasma gondii have any role in Alzheimer disease? Ozge Yilmaz Kusbeci 1, Ozlem Мітап, Mehmet Yaman, Orhan Cem Aktepe, Suleyman Yazar Affiliations + expand PMID: 20921875 DOI: 10.1097/WAD.0b013e3181f73bc2 Abstract Background: Alzheimer disease (AD), a chronic progressive neurodegenerative disorder, has a mainly unknown multifactorial etiology. Neuroinflammatory mechanisms might contribute to the cascade of events leading to neuronal degeneration. Central nervous system infections have been previously suggested as possible etiological agents in the development of sporadic AD. Toxoplasmosis can be associated with various neuropsychiatric disorders. In this study, we aimed to investigate the possible association between toxoplasma infection and AD. Methods: This study evaluated the serum anti-Toxoplasma gondii IgG levels. It included an age- matched and sex-matched study and control groups that consisted of 34 patients with AD and 37 healthy individuals, respectively. There were no difference between the socio economic states of the patients and control subjects. serecm anti-I-gondi IgG levels were measured by using ELISA. Results: According to the statistical analysis, there were no significant differences among the patients and the control participants with respect to age (68.05: 15.98, 62.91+5.89 y, P=0.072; respectively) and sex. The seropositivity rate for anti-T. gondii IgG antibodies among AD patients and control groups were 44.1% and 24.3%, respectively, and there was significant difference between the serum anti-T. gondii 196 levels (Р-0.005). Conclusions: Our findings suggest that toxoplasma infection may be involved in the pathogenetic mechanisms of AD. If confirmed, a positive correlation between toxoplasmosis and AD may lead to new approaches for the management of AD. Can parasites cause schizophrenia? Parasites as causative agents of human affective disorders? The impact of anti- psychotic, mood-stabilizer and anti-parasite medication on Toxoplasma gondiis ability to alter host behaviour J.P Webster D, P.H.L Lamberton, С.А Donnelly and E.F Torrey Published: 17 January 2006 https://doi.org/10.1098/rspb.2005.3413 Abstract inderstand transmissil infectious causation of both acute and chronic d and neuropathological studies indicate that dii. Reasons for this includ Are brain-eating parasites the cause of insanity? PSYCHOPATH It gets worse. 33 Can parasites manipulate their host into committing suicide? Suicidal Crickets Hairworms have a perpetual challenge: They infect landlubbing insects like crickets, but the parasites must make their way to an aquatic habitat in order to reproduce. Researchers at France's Centre National de la Recherche Scientifique figured out how they accomplish this feat. Hairworms produce mind-controlling chemicals that cause their cricket host to move toward light. Because water bodies reflect moonlight, this often sends crickets toward lakes and streams. The crickets jump in and drown, and the hairworms emerge, ready to find their next victim. 5 html nttps://www.livescience.com/21345-t-gondii-p ite-st e-attempt Cat Parasite Linked to Suicide Atte pts in © American Psychiatric Association .. H umans GAPAPsychiatric By Stephanie Pappas published July 02, 2012 The (9CDCgov is warning of an accelerating осеооо mental health crisis among adolescents, with more than 4 in 10 teens reporting that they feel “persistently sad or hopeless,” and 1 іп 5 saying they have contemplated suicide. pubmed.ncbi.nIm.nih.gov/21 Brain parasites and suicide David Lester | Affiliations + expand Women infected with the cat parasite Toxoplasma gondii are more likely to PMID: 21117467 DOI: 10.2466/12.13.PR0.107.5.424 attempt suicide than non-infected women, new research finds. The reason for this connection, however, remains mysterious Abstract In a sample of 20 European nations, the prevalence of the brain parasite Toxoplasma gondii was positively associated with national suicide rates for men and women. @ medicalnewstoday.com/articles/24923 Common Parasite Linked To Suicide Risk Testing positive for a common parasite that lives in the bodies of 10 - 20% of Americans is linked to a sevenfold higher risk of attempted suicide according to new research. This was the main finding of a study appearing in the August issue of The Journal of Clinical Psychiatry that supports growing evidence linking infection by the ЖЕСІРДІ) parasite to suicide attempts. It gets worse. seroprevalence of antibodies to T. gondii in people with schizophrenia is significantly higher than in control populations (OR=2.73, Р<0.000001).191 A 2009 summary of studies found that suicide attempters had far more indicative (IgG) antibodies than mental health inpatients without a suicide attempt.[19?! Infection was also shown to be associated with suicide in women over the age of 60. (P<0.005) 11931 Can parasites use epigenetics to suppress certain genes in a host? Can it select which genes are expressed? Т. gondii has been shown to alterithesbehavior of infected rodents in ways that increase the rodents’ chances of being preyed upon by ?еііі 11111511161 Support for this "manipulation hypothesis" stems from studies showing T. gondii-infected rats have a decreased aversion to cat urine.'""! Because cats are the only hosts within which T. gondii can sexually reproduce to complete and begin its lifecycle, such behavioral manipulations are thought to be evolutionary adaptations that increase the parasite's reproductive success. |!!! The rats would not shy away from areas where cats live and would also be less able to escape should a cat try to prey on them. The primary mechanisms of T. gondii-induced behavioral changes in rodents is now known to occur through epigenetic remodeling in neurons which govern the associated behaviors; [7118] for example, it modifies epigenetic methylation to cause hypomethylation of arginine vasopressin-related genes in the medial amygdala to greatly decrease predator aversion." 7/18] widespread histone-lysine acetylation in cortical astrocytes appears to be another epigenetic mechanism employed by Т. gondii. Differences in aversion to cat urine are observed between non-infected and infected humans and sex differences within these groups were apparent, too.21] manage it. Now a new study suggests H H that A т can turn its host’s https:/ / archive.is/ 03yIB genes on and off — and it's possible other parasites use this strategy. [19][20] Average facial landmarks Can epigenetic remodeling change a host's appearance? Could it change it enough to make the infected detectable by a trained observer? s" -for gay The study from Stanford University - hich found that a computer algorithm could correctly distinguish between gay and straight men 8196 o the time, and 7496 for women - has raised questions about the biological Ever notice that all the most diabolical villains throughout cartoon history all share the same distinguishing features? Parasitic and pathogenic fungi form symbiotic relationships with other living organisms, similarly to mycorrhizal fungi; however, they benefit to the detriment (and sometimes death) of their host. Many species affect trees and other plants. Others attack mushrooms, sometimes rendering the host species unrecognizable. 35 If parasites can change the appearance of its host, would this explain the ‘numale’ look? above - a fragment of the Sixte Chapel fresco "Тһе Last Judgment" painted by Michelangelo (1475-1564). Below is the current mayor of Chicago. Actions. лом yee Q & pubmed.ncbi.nim.nih.gov/23225875/ > J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635. Influence of latent Toxoplasma infection on human personality, physiology and morphology s Geet cons of the Toxoplasma-human model in studying the manipulation hypothesis Jaroslav Flegr ! Affiliations + expand PMID: 23225875 DOI: 10.1242/jeb.073635 Abstract The parasitic protozoan Toxoplasma gondii infects about one-third of the population of developed countries. The life-long presence of dormant stages of this parasite in the brain and muscular tissues of infected humans is usually considered asymptomatic from the clinical point of view. In the past 20 years, research performed mostly on military personnel, university students, pregnant women and blood donors has shown that this ‘asymptomatic’ disease has a large influence on various aspects of human life. View Same Google іб SsuceNAO Trace & bunkercuck jpg, 149KiB, 797x758 Anonymous ID:d0990zwM Mon 20 Sep 2021 21:50:05 No.340115610 ™ Report »muh А.І. facial composites You can change your jaw shape by keeping your tongue in place properly and eating tough foods, you can change your body shape and even skeletal structure with diet, exercise and through physical trauma It stands to reason that a lifelong, behavior-changing parasitic infection could do the same. Worm pill status: taken 37 Is promiscuous sex rampant in college? Would such promiscuous behavior expose otherwise healthy individuals to new parasitic infections? Would such infections then cause the host to CHANGE? МФ antes/depois AntesDepoisDaFederal lantes/depois ^ 1310 AntesDepoisDaFederal lantes/depois I$ antes/depois My senior year of high e скен ШЕШЕ Cropping ourmy 1st year ке Of college a — So whose gonna take one for the team and kill Kavanaugh? n 28.5 Can parasites turn a creature trans? Home / Science & Nature / Marine Science Undersea parasite turns male mud crabs female Marine Science, Science & Nature The world is full of parasites that can force their hosts to do strange, even suicidal, things. But very few can functionally switch an animals gender. One such parasite lurks in Chesapeake Bay: an invasive barnacle that hijacks a mud crab’s reproductive system and Image above: A mud crab infected with parasites. The sacs on its abdomen contain thousands of parasite larvae the crab will later release into the water. The invasive parasite Loxothylacus panopaei (Loxo for short) is a type of barnacle, but looks and acts nothing like the typical barnacles growing on rocks along the shoreline. Loxo has a highly evolved life cycle, essentially custom-made for acting as a crab parasite. As a free-swimming larva, Loxo resembles a typical barnacle larva. A female larva infects a recently molted crab by burying into its shell. Once inside, she undergoes a series of changes and assumes control over the host crab, dictating major functions such as molting and reproduction. Abstract Gender identity disorder (GID), recently renamed gender dysphoria (GD), is a rare condition characterized by an incongruity between gender identity and biological sex. Clinical evidence suggests that schizophrenia occurs in patients with GID at rates higher than in the general population and that patients with GID may have schizophrenia-like personality traits. Conversely, patients with schizophrenia may experience alterations in gender identity and gender role perception. Neurobiological research, including brain imaging and studies of finger length ratio and handedness, suggests that both these disorders are associated with altered cerebral sexual dimorphism and changes in cerebral lateralization. Various mechanisms, such as Toxoplasma infection, reduced levels of brain-derived neurotrophic factor (BDNF), early childhood adversity, and links with autism spectrum disorders, may account for some of this overlap. The implications of this association for further research are discussed. 16/0960-0760(95)00062-5. > J Steroid Biochem Mol Biol. 1995 Jun;52 doi: 10.10 Sex hormone changes induced by the parasite lead to feminization of the male host in murine Taenia crassiceps cysticercosis C Larralde 1, J Morales, | Terrazas, Т Govezensky, M С Romano amano bapana MEN What happens if your endocrine system gets PMID: 7779761 DOI: 10.1016/0960-0760(95)00062-5 disrupted? LINK Abstract Female mice are more susceptible to Taenia crassiceps (TC) infection than males, However, after a month parasite load increases massively in both genders reaching thousands of parasites per host. The possibility of hormonal changes in the infected mice was envisaged. Sex hormones levels were assayed after different periods of infection, the parasites present in the peritoneal cavity were collected and gonads, uterus and seminal vesicles were weighed. In male mice, serum estradiol increased to levels 200 times their normal values whilst those of testosterone decreased 90% relative to controls. The weight of seminal vesicles was significantly diminished. Infected female mice also Watching the parasites fully transition a host can now be seen thanks to digital recording and online upload- ing by the infected: Is he gay? > м x) 001/1156 Гат Gay (Coming Out Story) ЕЗ Gigi Gorgeous Subscribed Ж 2299604 2,877,807 views wm gus Is he transgender? b м 4) 0007408 | Am Transgender | Gigi 23 Gigi Gi Ty Gigi Gorgeous ý Subscribed | Ж | 239960 Is he a lesbian? P» м 4) 004/828 I'm a Lesbian | Gigi Gigi Gorgeous ^ Is he a dog lover? М 4) 001/1254 | HAD SEX WITH А DOG | Gigi 5 сс Gorgeous ^ ..or is he just infected? UM 41 I'll throw out a few scary facts: fact #1: there are over 50,000 known stds #2: we only test for 10 of them #3: stds are caused by various types of parasjtes #4: one of the most common parasites in the US can cause people to become tráns. #5: this same parasite is linked to causing suicide in the host. Are trans people known for high rates of suicide? & hrcorg/news/new-study-reveals-shocking-rates-of-attempted-suicide-among-trans-adolescen New Study Reveals Shocking Rates of Attempted Suicide Among Trans Adolescents by HRCStatt - September 12, 2018 Harrowing statistics from a study revealed alarming levels of attempted suicide among transgender youth. Post submitted by former Editorial Producer, Print and Digital Media Rokia Hassanein Harrowing statistics from a study recently published by the American Academy of Pediatrics revealed alarming levels of attempted suicide among transgender youth -- with the highest rates among transgender boys and non-binary youth. The findings emphasize the urgency of building welcoming and safe communities for LGBTQ young people, particularly for transgender youth. oftransgender male teens who participated in the survey reported attempting suicide in their lifetime, while 29.9 percent of transgender female teens said they attempted suicide. Among non-binary youth, 41.8 percent of respondents stated that they had attempted suicide at some point in their lives. Can parasites manipulate a host’s endocrine system? LINK Would the same parasite that locates a different gland in a different host, then manifest different changes in the second host? Q @ pubmed.ncbi.nim.nih.gov/23225873/ Toxoplasma gondii infection and behaviour - location, location, location? Glenn A McConkey 1, Heather L Martin, Greg С Bristow, Joanne P Webster Affiliations + expand PMID: 23225873 PMCID: PMC3515035 DOI: 10.1242/jeb.074153 Free PMC article Abstract Parasite location has been proposed as an important factor in the behavioural сһапде 31 7T 1 rodents infected with the protozoan Toxoplasma gondii. During the chronic stages of infection, encysted parasites are found in the brain but it remains unclear whether the parasite has tropism for specific brain regions. Parasite tissue cysts are found in all brain areas with some, but not all, prior studies reporting higher numbers located in the amygdala and frontal cortex. A stochastic process of parasite location does not, however, seem to explain the distinct and often subtle changes observed in rodent behaviour. One factor that could contribute to the specific changes is increased dopamine production by T. gondii. Recently, it was found that cells encysted with parasites in the brains of experimentally infected rodents have high levels of dopamine and that the parasite encodes a tyrosine hydroxylase, the rate-limiting enzyme in the synthesis of this neurotransmitter. A mechanism is proposed that could explain the behaviour changes due to parasite regulation of dopamine. This could have important implications for T. gondii infections in humans. If one location of the brain was infected, could March 2019 (32)- Now(35). Faking happy versus actual happy. 27 months this result in the host acting homosexual, but if a ыды Always wanted a cute goth girlfriend, but then I became her. different location was infected, could this result in the host acting like a tranny? Or a furry? Or any other kind of degeneracy? What are sexual fetishes? What [really] causes sexual fetishes? | Anonymous 03/02/12(Fri)17:39 No. 1921453 If only you knew how bad things really are The 'numale' look is early-stage parasite infection. The ‘Tranny’ look is late-stage. 43 Transition Complete: Michelle Obama's librar htups://weh.archive.org/web/20190908169014/https:/ /www.pinknews.co.uk/2017/10/1/7 an-amazing-demon-drag-queen-has-entertained-children-in-michelle-obamas-library/ Dancing with your pet worm: LINK 44 Can parasites give you a sadomasochism fetish? LINK Have you ever wondered why some girls always fall for “bad guys"? [they are infected] The Relation of Toxoplasma Infection and Sexual Attraction to Fear, Danger, Pain, and Submissiveness Jaroslav Flegr, Radim Kuba First Published August 1, 2016 | Research Article | 8) Check for updates https://doi.org/10.1177/1474704916659746 Article information v | Altmetric 340 Ó Abstract Behavioral patterns, including sexual behavioral patterns, are usually understood as biological adaptations increasing the fitness of their carriers. Many parasites, so-called manipulators, are known to induce changes in the behavior of their hosts to increase their own fitness. Such changes are also induced by a parasite of cats, Toxoplasma gondii. The most remarkable change is the fatal attraction phenomenon, the switch of infected mice's and rat's native fear of the smell of cats toward an attraction to this smell. The stimuli that activate fear-related circuits in healthy rodents start to also activate sex-related circuits in the infected animals. An analogy of the fatal attraction phenomenon has also been observed in infected humans} Therefore, we tried to test a hypothesis that sexual arousal by fear-, violence-, and danger-related stimuli occurs more frequently in Toxoplasma-infected subjects. A cross-sectional cohort study performed on 36,564 subjects (5,087 Toxoplasma free and 741 Toxoplasma infected) showed that infected and noninfected subjects differ in their sexual behavior, fantasies, and preferences when age, health, and the size of the place where they spent childhood were controlled (F(24, 3719) = 2.800, p < .0001). In agreement with our a priori hypothesis, infected subjects are more often aroused by their own fear, danger, and sexual submission Can parasites change your sexual preferences? news.stanford.edu/news/201 brain lights up v anticipation of ro hown invading neurons is are fluorescently Why change the host’s sexual preferences? Is it because parasites are using sex to infect new hosts? 45 Can parasites change your sexual preferences? LINK Can parasitic infection turn you gay? & pubmed.ncbi.nlm.nih.gov/2959888/ Q P gov > Nutr Health. 1987;5(1-2):95-7. doi: 10.1177/026010608700500212. The effect of fungal toxins on the sexual behaviour of rabbits М Nilsson 1, O Lindahl, L Lindwall Affiliations + expand PMID: 2959888 DOI: 10.1177/026010608700500212 Abstract Feeding rabbits with mycelium from Fusarium roseum is shown to produce infertility, the disappearance of aggressivity, and homosexual behaviour in males, while the effect of the females is only infertility. This mycelium contains the mycotoxin zearalenon which has effects similar to those of the female hormone. This fungus willingly grows on common crops and is consumed both by people and animals-although normally in very low doses. It cannot be ruled out that an increased growth of fungus, due to artificial fertilization, which then can be demonstrated to be found in food and consumed, can be a factor which increases the incidence of homosexual behavior in people. Do you have indoor plumbing? 5 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3232942/ J Clin Microbiol. 2011 Dec; 49(12): 4264—4272. PMCID: PMC3232942 doi: 10.1128/JCM.05468-11 PMID: 21976755 Widespread Occurrence of Diverse Human Pathogenic Types of the Fungus Fusarium Detected in Plumbing Drains — + Dylan P. б. Short, Kerry O'Donnell? Ning Zhang? Jean H. Juba,’ and David M. Geiser’ » Author information > Article notes + Copyright and License information Disclaimer Associated Data + Supplementary Materials ABSTRACT Goto: » It has been proposed that plumbing systems might serve as a significant environmental reservoir of human-pathogenic isolates of Fusarium. We tested this hypothesis by performing the first extensive multilocus sequence typing (MLST) survey of plumbing drain-associated Fusarium isolates and comparing the diversity observed to the known diversity of clinical Fusarium isolates. We sampled 471 drains, mostly in bathroom sinks, from 131 buildings in the United States using a swabbing method. We found that 66% of sinks and 80% of buildings surveyed yielded at least one Fusarium culture. A total of O Anonymous (ID: Ф127) zz 10/05/21(Tue)12:33:12 No.342235198 > | had crazy anal fixation until | dewormed myself, now the thought of sticking my dick in a pooper is fucking grossing me out. what in the fuck ??? Also why do you guys buy all kind of crystal lady suplements | went to the pharmacy and just told the lady | had worms and didn't know which so she gave me some meds that work against many kinds and took the top dose. Homosexuals have an astoundingly high rate of infection by parasites. According to the national institute of health, 70% of all homosexual men are infected with intestinal parasites, as opposed to only 10% of straight men. https://pubmed.ncbi.nlm.nih.gov/7437971/ This astoundingly high rate of infection by parasites might then explain why homosexuals have such an increased urge to fornicate. These intestinal parasites always need new hosts. Without a viable vector of transmission, the parasite dies. The incredibly high rate of parasitic infection amongst the homosexual population explains why they are so sexually degenerate. Their behavior is being altered in much the same way as the rat's behavior is altered by toxoplasma Gondi in order to allow to parasite to survive. = ж This would also explain why the media is freaking out about ivermectin. Ivermectin is potentially the most effective parasite removing drug available. An anecdotal case in my family gives me strong suspicion that ivermectin might actually be a cure for homosexuality. My cousin was a homosexual, until he was prescribed ivermectin for covid. After taking ivermectin, he filled a toilet bowl with intestinal worms. Shortly thereafter, he lost all attraction to men, and found women sexually attractive. He was repulsed by his previous nature. t. gondii homosexual Web Images Videos Any time d Advanced Central-nervous-system toxoplasmosis in homosexual men and ... https://www.ncbi.nim.nih.gov/pubmed/6691657 Anonymous View Ann Intern Med. 1984 Jan;100(1):36-42. Central-nervous-system toxoplasmosis in homosexual теп and parenteral drug abusers. Wong В, Gold JW, Brown AE, ... Does Toxoplasma infection increase sexual masochism and ... - NCBI https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5731508/ Anonymous View Nov 28, 2017 ... Other factors correlated with toxoplasmosis, e.g., zoophilia and homosexual sex (not the homosexual orientation), had no direct relation to ... Toxoplasma gondii - RationalWiki https://rationalwiki.org/wiki/Toxoplasma gondii Anonymous View Toxoplasma gondii is a parasitic protozoan that causes toxoplasmosis in humans and .... It's possible that the initial association of T. gondii with homosexuality is ... The Relation of Toxoplasma Infection and Sexual Attraction to Fear ... https://journals.sagepub.com/doi/full/10.1177/1474704916659746 Anonymous View Aug 1, 2016 ... Keywords Toxoplasma gondii, sexual behavior, sadism, sexual domination, ... It has been, for example, suggested that male homosexuality can .. іп a controlled study 67.596 of 200 homosexual men but only 16% of 100 heterosexual men were found to be infected with intestinal parasites. Is this really me? Parasites and other humans' cells in our b https;//www.ncbi.nlm.nih.gov/pmc/articles/PMC1704818/ The emergence and spread of intestinal parasites is of public health concern particularly in the homosexual community. https://www.researchgate.net/publication/267 16190 _Sexual_transmission_of_intestinal_parasites_in_men_who_have_sex_with_men These findings suggest that E. histolytica is a common commensal in the homosexual population https://www.nejm.org/doi/full/10.1056/NEJM 198608073 150603 76/133 (57 96) asymptomatic homosexual men harboured intestinal parasites. https://www.tandfonline.com/doi/abs/10.3109/00365548409087142? ournalCode-infd19 ) = 10/01/21(Ғгі)22:11:23 No.341715263 > ms.png (3.67 MB, 1300x1300) 22341699221 Fucking nuts. When I was in Navy bootcamp circa 2011 there was a guy that came out of the head looking frightened as fuck. Something was off about him though. He was kind of walking differently, like he was іп a rush but he seemed more collected. Turns out he filled up the shitter with worms. He said later he could see them “writhing” around in the shit. | chocked it up to the galley not cleaning and accepting subpar ingredients. But we all noticed he dropped his affected gay accent- you know the kind that gay guys universally attempt. Anyways, he stuck around a couple of days until he could be discharged. He didn't do the same walk or gesticulations and he stopped affecting that accent altogether. One guy, a nuke who maxed his ASVAB score, told me he thought they put something in the food that made him shit out parasites. | though he was crazy and just assumed Occam's Razor, still assuming it was the galley's lack of cleanliness and all that. But the nuke told me one more thing: that the guy confessed to not being gay anymore. He was revolted he told us all the shit he used to do and would like to do once he got out. He was a completely different person. -All т saying is that maybe this is more than random 4chan bullshit posts. It's anecdotal, like OPs pic, but there's something to it all. 47 @ ncbi.nlm.nih.gov/pmc/articles/PMC269003/ m Journal of Ea, | Clinical Microbiology’ J Clin Microbiol. 1986 Oct; 24(4): 684—685. PMCID: PMC269003 doi: 10.1128/jcm.24.4 684-685 1986 PMID: 2877006 Prevalence of enteric parasites in homosexual patients attending an outpatient clinic. C S Peters, R Sable, W M Janda, AL Chittom, and F E Kocka » Copyright and License information Disclaimer This article has been cited by other articles in PMC. Abstract A total of 372 pooled stool specimens from 274 homosexual men with diarrhea were submitted for parasitologic examination over a 2.5-year period. Each two-vial pooled specimen set contained portions of stool from 3 consecutive days in Formalin and polyvinyl alcohol. Of the 274 patients, 133 (48.595) harbored one or more intestinal protozoa, with 161 (43.396) of the 372 specimens submitted being positive for one or more organisms. The parasites identified included Entamoeba histolytica (71 patients), Giardia lamblia (22 patients), Endolimax nana (106 patients), Entamoeba coli (39 patients), Entamoeba hartmanni (25 patients), Dientamoeba fragilis (3 patients), lodamoeba bütschlii (2 patients), and Chilomastix mesnili (2 patients). Cryptosporidium sp. (2 patients) and Isospora belli (1 patient) were also detected. Results of this study support the experience of other workers regarding high rates of infection with intestinal parasites in the homosexual population and also indicate that symptomatic individuals belonging to this acquired immunodeficiency syndrome risk group be screened for both common and uncommon intestinal pathogens. DIRECTOR ANDY SERKIS SAYS ‘VENOM: LET THERE BE CARNAGE’ IS A GAY ROMANCE WITH COMING — | OUT PARTY’ SCENE 09/30/21(Thu)08:20:50 Мо.34152 >two men infected with a parasite try to kill eachother »its a gay romance ЕСЕ This woman can kill the “worms” that turned you gay By Daniel Villarreal April 24, 2019 at 10:04am - 53 comments TRANSLATED By MRI «= TV https://www. queerty.com/woman-can-kill-sperm- hungry-anal-worms-turned-gay-20190424 г i ы ч Dr. Mariam Al-Sohel has some meds for you, but they aren’t oral. Meet Dr. Mariam Al-Sohel, a supposed “Kuwait! New-Age Therapist and Human Development Advisor.” She has discovered therapeutic suppositories that'll curb your excessive homosexual urges. That's right! While science still struggles to understand whether homosexuality Is caused by genetics, social factors or Just normal human desire, Al-Sohel knows what actually causes teh gay — and It ain't genetics. She explains: "The sexual urge develops when a person Is sexually attacked and afterwards it persists, because there Is an anal worm that feeds on semen." “Praise be to Allah,” the show's host says. Related: New Pill Will “Cure” Homosexuality In 8 Sad, Delusional Months Walt a sec... so being raped or molested somehow causes an anal worm to spontaneously grow іп your butt? Intriguing! Please, continue doctor: “So what | did was to produce suppositories, which are to be used by certain people at a certain time, and It cures those urges by exterminating the worm that feeds on sperm." ous (ID: GHEE) = 09/28/21(Tue)09:45:02 No.341254452 |» >>341254585 >>341254733 >>341256151 >>341256765 >>341253329 They release toxins into the stomach and brain. Used to Бе a fag until | detoxxed myself. Getting rid of parasites and worms isn't a meme. | broke up after detoxing myself after having a relationship for 3 years. Feels disgusting to think back about what 1 did. nonymous (ID: ШЕШЕ) = 09/28/21(Tue)10:40:10 No.341260569 > >>341260021 Hope it works fren. | noticed a different after the first try, then soon after the gay went away. You might get some headaches but that's the parasites being gassed. Getting extra iodine into your system might also help as protection, but I'd first try the shit | recommended. nonymous (ID: CHEE) = 09/28/21(Тие)10:18:01 Мо.341258041 P >>341250681 >>341256765 >The worm made me lazy and unfocused, Yeah same here. I never was hedonistic in the sense of fucking everything that walked past, neither was the ex, guess that is the exception to the rule. Also | started to lose weight pretty easily again, depressed moods stopped and the alcohol and sugar cravings stopped right away, both two things parasites and worms love. Brain fog and feeling like total shit in the morning also is gone. | too feel reborn. How to cure the Gay: LINK 49 Do homosexuality and trannyism appear to be infectious diseases, epidemiologically? Is it far more frequent in children raised in densely populated areas? Does it occur in some societies and not others? Is it spreading at an accelerating rate? Number of Pediatric бепдег Сііпіс5 in 2007. MONTANA MINNESOTA Ottawa Montreal 11 Toronto Define Outbreak. New York NU WIJSITE солт Q Houston FLORIDA NEWS Teacher says 20 of 32 fourth-grade students have ‘come out’ to her Number ofpPediatric Gender Clinics in 2022 үз as ‘LGBIQIA+’ A leaked internal message reveals the elementary school teacher who claims over 60 percent of her students are LGBTQIA+ also said it is not enough’ to just celebrate 'Queer folx.' Are there multiple subtypes of gay men? Are we looking at multiple opportunistic species? Or are different "types" of gays just at different stages of the parasite's lifecycle? Or do they represent people with active infections and people in remission? Americans who self -identified as LGBTQ in 2021, by generation za 112,415 U.S. ueluti Conducted betwee It is spreading like a disease because it is one. , Мі: lenials odxvx4QZ Gen X Бот E Baby boomers i3 Traditionalists 20.8 10.5 т ( а [^] 50 bug chaser Describes a person trying to acquire PARASITES The doctor said, "This patient is regularly having unprotected sex with different partners. He might be a bug chaser." New Member Username: Curndmp Post Number: 1 Registered: 04-2008 Username: Vinsteri Post Number: 32 Registered: 07-2007 Posted on Monday, June 01, 2009 - 06:35 pm: I met this dude online today. Big 8 1/2 poz dick. I got him talking about it. Said his strain was strong. Lethal. Toxic. Poison. My dick fuking sprang up and I started begging him. I went over... I started hitting my pipe, he did a slam. I licked him blood off his arm. I had to have his strain. I wanted him to infect me so bad. I was begging for it and he went to the bathroom. He came back with a syringe full of his blood. I'd never had another dude's blood before. 1 stuck my hole up and he shot it inside me.. scratching around. Then he fucked me and he shot.. mixing his babies with his toxic blood. So fucking hot. I know I'm gonna get a whole fuck flu from this shit. It's so strong. Then I went to the bookstore and let 5 dudes fuck me and grind it all into me. I'd never had something so hot inside me. I had to get it to take. He's gonna start knocking me up regularly and 1 can't wait till his shit is saturating me and producing inside of me. Woof. Posted on Monday, June 01, 2009 - 07:35 pm: FUCKING HOT. GO FOR IT. I WOULD Posted on Monday, June 01, 2009 - 07:39 pm: Wow. Made me instanTly hard. Did you hiT the pipe, too? Or slam? Posted on Tuesday, June 02, 2009 - 12:05 pm: that sounds fucking hot man, love feedin on blood like that too and love tops gettin off on sharing all they've got 51 P Я r/TrueOffMyChest [ Join | t1 Toxic Masc @ Retweeted u/ButteredSalmon * 1y Poz Breeder А 4 я @PozBreeder As a bug chaser, going out in public without a mask is very sexually exciting. My fave pig І knocked up and who | still Many people think bug chasing is limited to the breed just found out he knocked up his reception HIV, however to some people like myself, first bottom bitch. My strain lives on. catching other diseases can provide the same kind #poz #gifted #bbbh of thrill that a bug chaser gets when being intimate with someone who has HIV. ТҮРЕН ҚАРЫНЫ The other day | walked into my local supermarket 7 Retweets 32 Likes and immediately felt a tingle of sexual excitement as | was the only one in sight without a mask on. As | continued through the store | found myself Q у Q М walking against the guided routes that shoppers are supposed to follow and breathing as heavily as Ф Larry Hewes & @Poz4Chasers · 2d possible to satisfy my sexual desires. Even the looks Replying to @PozBreeder | got from the Karens couldn't stop the rush | was Congratulations on your new "grandson"! So getting. | know that wearing a mask and following glad to hear that his "father" is still toxic. Are safety procedures is extremely important right now, you still toxic? And аге any of you 3 guys i 1 "aeree qum s but | have never felt so alive than | was when I was in interested In being Gifters? There are a hundred that store chasers for every Gifter globally. | am glad to refer all Gifters to chasers in their area. T Vote ғ, C) 5 ac Share Tweet your reply Q r/CuckoldCommunity "ee > The bull is HIV positive | NSFW | I've been rock hard since І found out. | talked to my wife and she promised that he'd always be wearing a condom. My wife is currently pregnant and the idea that only a thin bit of latex prevents his supercharged POZZED load from infecting my wife and her baby is the most erotic thing ever! 85598100 >>388598919 >>388599486 >>388599500 >>388599648 >>388600076 >>388600376 >>388600575 >>388600676 >>388601460 Toxic: Carrying AlDS/other diseases. Strain: The strain of HIV a person is carrying which they imaginarily lend significance and empowerment to, claiming their strain is strong and others should want to be infected with it Gifter: Someone who gives the gift of AIDS to others. Bug chaser: Someone who actively seeks out and fetishizes infection by AIDS as the gay version of getting pregnant Breeding: Ejaculating inside another man's rectum with HIV positive semen to infect them with the virus Impregnating: Infecting someone with the virus IV Drip: Doing a direct blood transfusion of a gifter's AIDS blood Funneling: Accumulating numerous positive men's semen into a container and pouring it into an opened rectum with a funnel for the purpose of infection with AIDS Doublebugged (and triple, quadruple, etc): Being infected with multiple strains of AIDS from multiple gifters intentionally. Pig: A submissive male who enjoys being penetrated by other males and in particular enjoys it in an unclean manner involving unshowered, sweaty men often with an element of feces or urine. San Francisco Special: Having a party in which multiple gifters infect other bugchasers with the virus as the basis of the gathering Initiation: A ceremonial infection of a new gifter to begin breeding and impregnating others with AIDS. Xenomorph: An HIV positive gay man who preys on negative gay men to infect them without them knowing, and then is sexually aroused by the thought of the virus surprising them from within their bodies like giving birth to a horrible monstrosity. Cocktail: A mixture of multiple HIV positive men's semen Sounding Spreading: The spreading of the AIDS virus by injecting infected semen into the urethra of the recipient instead of the rectum Black Bug Chasers: Gay men who specifically seek out infection with HIV from black men under believe that black HIV is superior. Zyklon-B: A term used to refer to infected semen being put into a Jewish gay man. Why do social media platforms censor facts but allow pedophilia advocates? LINK Why is pedophilia protected by those with power? LINK Is there an advantage to the parasite when the parasite infects a young host? Does a child's weaker immune system make it more susceptible to parasite infection? Worms in childhood Category: Child Health Topic: Infections and Parasites Ез Send by email [xj Viewas PDF &3 Send by post Threadworms, also called pinworms, are tiny, very thin white worms about 5 millimetres long that live in the intestine and around the anus (bottom). They are very common and widespread in Australia and are easily treated. Although people of any age can get them, with the infection spread through worm eggs on contaminated surfaces. Infection with other worms such as roundworms, hookworms and tapeworms is less common. Can the parasite gain greater control over the host the longer the parasite remains inside the host? How do homosexuals reproduce? Do parasites influence the host to engage in pedophilia in order to spread to more vulnerable hosts? Who is Wilhelm Reich? Why did he conclude that sexual degeneracy was communicable? What is the average age of a homosexual's first sexual encounter? How do homosexuals [really] reproduce? RAMROD - ^ Description etka: Alex Garcia бола .» RAMROD, South Florida's Levi/Leather/Uniform/Bear Bar is the South's #1 About > Yesterday at 1108 AM Cruise bar. Discussi ies ATTENTION!!! Ramrod is a Leather,Levi and Uniform Bar. We are | Alex's post welcoming to all Patrons that identify as such. Leather/Kinkster Folks of all Members identities are welcome and will be treated with Respect. Ramrod does not Events BI condone any Racist, Transphobic, ог Misogynistic Behavior in our establishment. Also remember Consent is not just sexy its MANDATORY!!! Videos How old were you the first Files time you had dick? month. Great Music and tons of fun to ensure that this will be a party you don't want to miss. Photos Pig Dance is an institution here in South Florida. 1st Saturday of every Recommendations The 3rd Friday of Every month we host ManDance, this is the biggest Bear h oup Q CUT Я Dance Party in town. Hosts some of the hottest DJs in town. Jeff CubHunter 6 5g J Paul-Anthony Andrada 6, Played Dr. @ an early age. With school Ej Denis Sabol 13 Like - 1d оа 5 Е kids my own аде!!!!Кеаѕоп why I'm Top/Vers. 1 Оов Like · 1а А 5 Like - 1d - Edited " i SELIM GRD 15) у Lj Sosa | think | was around 7. It was just curious boy stuff. Like - 1d (ез Rob Velasco 17 Like - 1d Оз: Mido Mido Craig J. Chamber! t pus ido Mido Crai amberlain i want you E 9 ! y Жж Rober Isidoro Gomez Castillejo 14 ma Like - 4h ve | Jerry Meek 19 i Gerald Johnson 5 1 Like - 1d - Edited а= n Like - 1d Like · 1d Michael Wesley 14 b Tips ud E Jose Calera 14 | was and still am the bottom ЖЕ E Like - 1d 2 David McCartney Was born with one. О Dominick King 8 years old a Like - 1d Ов : Like - 1d 5 Like - 1d Louis C Harris 10 =a A > - a Paul Wright 8 Qi з : Like · 1d 2 Kerry Herbags 21. | think | was a late bloomer. dir David Hughes 9 ike 3 Like - 1d Like - 1d Jordan Miguel Adı 16 "n ordan Miguel Adorno A Mark Reilly 12 ' Like - 1d vd Brian Thornton 14 Qa? Kk Jesus Ramirez 7 Like - 1d ры М | m 4 2 Like - 1d Like - 1d ayne Smith 1 И 2 m Velvet Hammerschidt 12 Like - 1d Chad Davis So early | can't remember Qa? т Adam Gregory 15 іп a glory hole in public toilets 282 Р Like - 1d Os: Mi R Obert LeFevre 18 asia Like - 1d rt Бы лд Аы 6 Rodney Nelson 11 Like - 1d кі Donnie Wayne 6 - 7 Qu [| Jerry Schooley 10.... with neighbors grandson on top of sta m Qoa: Like - 1d old newspapers in her garage ! Still love that ink smell! e 53 ВЕ Kelly Farmer 14 О: Like · 1d E Mido Mido Kelly Farmer so handsome Like - 4h Like - 1d Bl Dane Sheldon Rod Paul Andrés Exactly the same! Like - 1d a John Perry 13 Like - 1d o: Darrll Morales 20 Like - 1d Rod Paul Andrés 4 but the first time | enjoyed it was 16 «225 о 2 Like - 1d ж Hide 14 Replies Ronald L Peck 13 Like - 1d Gary Simons 16 Like 14 Chet Ford 8 with a cousin who was 12 and һе has a 11.5 inch cock I think that's why | am a bottom now Ose" Qo: Mark Miller-Schott 10 mas Е Bob Lilly 611 (is 5 Like · 1d Like - 1d - Edited Philip La Vigna was 5 grade. but relly around 5 with a boy г Like - 1d Michael Harness 15 Like - 1d E Bob Lilly It was a cousin and we fooled around for years. о: Rod Раш Andrés Dane, don't get me wrong, it wasn't horrible, | just couldn't comprehend what was really happening. It began at 4 could have been a little earlier, | have some strange memories but can't be certain they're not manufactured, and went through 13 with various individuals. When 16, | became involved with a military person 20 years older... looking back | recognize that these individuals were child predators. No harm, | survived and don't have any ill will towards them. [E Like 14 Dane Sheldon | was tied to a tree and forced to perform oral. Had numerous additional unwelcome experiences. Finally had a nice experience when | was in my late teens. Still harbor some resentment towards the original perpetrator but have become comfortable with myself, with who | am, and what | enjoy (albeit a little different than most). Like · 1d a N Eric Heiselt 15 - scout camp; real sex was 18 with my hockey coach 4 Like - 1d os У Ally Тот Ifamilik М Eric Heiselt that must be hot?? Like - 23h М Eric Heiselt Ally Tom Ifamilik didn't appreciate it then. But | still love a hairy daddy with a touch of silver. Yummm Like - 23h View 4 more replies Mark Williams 19... Raped by my dad in 5th & 6 th grades but. 8 Like м 1d - Edited Ally Tom Ifamilik Mark Williams for real tho?? No way. Like - 23h Mark Williams Ally, | entered male survivors of sexual abuse therapy in January 2011. Finally, | began to deal with the loss of my childhood. О: Like - 21h Like - 1d M Bob Bier Chet Ford hopefully you and your cousin still hook up Like - 1d e: Chet Ford Bob Bier no we haven't hooked up since he was 19 and | was 15 Like - 1d Mark Parker Chet Ford wow! Start big or go һоте!! Like · 1d Chet Ford Mark Parker it hurt like hell. Got used to it when I was 12 Like - 1d o р Bob Bier Chet Ford 4 years of hurt, that's a long time Like · 1d Chet Ford Bob Bier well we didn't see each other that much between the first time and until | was 12 then | started to like it. That might be why I like big cock now. Don't get me wrong a nice average cock is nice but the bigger ones are nicer Like - 1d Fredrick McLeod | was raped by my dad at 3 Ва |Ы Kelly Paris sorry to hear that! Шке 1d Fred Mclean Fredrick McLeod so sorry to read that Like - d o: Fredrick McLeod He raped me again at 18. The only reason | even went back around him was for my grandmother. Now | am free from him. ё Like - 22h L Те О: ke] Draigh Lunara 12 and a half Ally Tom Ifamilik Mark Williams man | dont understand stand.. your dad raped you?? That is nuts.. Like · 18h David Andreas VonLuvinbalz 12. Red head 9” older Daddy Ose: Like - 1d к Bob Bier David Andreas VonLuvinbalz voluntary? Like · 1а David Andreas VonLuvinbalz Bob Bier yes. | initiated Like - 14h dia Оз: Z£ABABEH PEP E Brent Ard Somewhere between 8-10. Оз: Like - 1d Mike Stonecypher 11 Like - 1d Like - 1d Leoke Picqueur 8 Оз: Like - 1d Colt Harrell 7 3 Jose Rivera 14 delicious Оз о 1 Like - 1d Like - 1d Brad York 11 with a cousin Brent Thomas Hill 16 Like - 1d 05 2 Like - 1d Alex Warner 17 honestly George Fain 20 Like - 1d Like 14 Edmund DeSantis 23 Andrew Jones 13 QQ 2 Like - 1d Like - 1d - Edited Joe Paul 17 Daniel Miles 14 Like - 1d Like · 1d Scott Smith 7 4 David Ayotte 24 Оз Like - 1d Like - 1d Rod Reynolds 17 Lie Id кимна ШЕН Stephen Folse 12 Q: Like · 1d Brian Young-Walls 7, with my best friend. Like 1d Оз s Jeff Beacom 10 with a kid my own age. 16 with a guy in his 30s Mark Hill 11 (Du 1 Like - 1d Like - 1d Like - 1d - Edited Like - 1d Ted Moxley ! guess 8 or 9 playin with buddies mine was always hard theirs weren't... && Ой: Chen Elbilia 5-6 raped by a neighbor 9: к Bob Bier Chen Elbilia @ Like - 1d Norman Stanbury 11 Like - 1d о: Bob Bier 26 for blow, 28 for anal От о 2 Like - 1d Henry Martin 13 1 Like - 1d Chris Perez 5 (Dis 5 Like - 1d Greg Nixon 14 Like - 1d Michael Hoyh 7 Оз: Like - 1d Gary Robert Potter 14 Like - 1d Scott Haldeman 12 Like - 1d 2 2 Matthew J. Zafferas 12 Like - 1d Eric Gunderson 11 0: li EE Eg EE HW Like - 1d ою 54 EOS ju БЕРР Like · 1d Like - 1d Like · 1d Allen Belluomini 18. Late bloomer. But I've made up for lost time. 02%: Like - 1d Jim Madigan 12 Like · 1d Casey Lloyd Ford 14 Like - 1d ; David Wasserman 5 or 6 Like · 1d » 6 Bob Lilly David Wasserman me tool Qa: Like - 1d David Wasserman Bob Lilly My brother's and my best friend's lá Оз: Like - 1d Bob Lilly David Wasserman my cousin and his friend they were in their teens!!! And my father did too! | didn't like that at all. But had too!!! Ugh! He finally moved away with another guyl 1 Like - td @ Bob Lilly My father | mean. But the others were greatll! Like · 23h Billy Bowles 12 Like - 4d j Filimon Campos 16 Like - 1d Mike Roth 11 (Dis 2 Like - 1d Brent Ard Somewhere between 8-10. Oa: Like 14 Mike Stonecypher 11 Like - 1d John Whitlock 24 Like - 1d Justin Richardson 11 ues Ой? Matías Roberto 16 Like · 1d Joshua Bowman 12 о: Like - 1d Arthur Danby 14 Like - 1d Richard Navarro-Vincent 25 Like · 1d Joe Murray 12 2 Like 1d Dave Carey 7 ©) 4 Like - 1d Ronald Podesta | was 10 3 Like - 1d Өз Chad A-bomb Prince 21 Like - 1d Scott Smith 7 to 14 much older cousin 14 to 18 Reverend Foxworthy [E Jay Dick 13 Like «© p Michael Hochhalter 8 On: David Kerr 8 Э | Michael Vargas | was б not going into details to dark and pervy for Like - 1d 0: the book. Enjoy ur day oa: John Gonzales 12 on an 18 year old hairy guy && Like - 1d Like - 1d Roberto Vela 37 Like - 1d MI Bob Bier Michael Vargas willing & or forced 3 ? Angelo Russo 20 with а fiend |5 very beautiful Like 1d Like - 1d - Edited William R Altmeyer 21 Michael Vargas Bob Bier mixed Leo-Hubert G Kelly 13 or 14 Like - 1d Like · 1d Like - 1d William Dangler 12 Qo? Kelly Paris Happened to me at the same age as well Jackie L Walton 34 Like · 1а Like 1а Like - 1d Rik Hepner Womb outing day, was part of my original equipment Michael Vargas Kelly Paris so u get it Kevin T Casey 8 E Fok SE Dennis Eveleigh 43 Tom Penman 15 Michael Peacock 7 Like - 1d " Like - 1d Like - 1d о У Like · 1d Ou? Gordon Nesheim 14 Uke 1d strict Catholic upbringing 3 Like - 1d Ruben Ortiz 11 a meta о 1 3 Wyatt Greenmen Was а couple older boys about 16. | " a Kelly Paris Michael Vargas yeah. Not sure if your experience remember incredible excitement. Would re-live it in a was like mine, but there ya have it. heartbeat ... Derek Bennett 4 or 5. Next time was much later, thank god O82 os Like · 1d Like · 1d Like - 1d ғ Michael Vargas Yea my father raised те... alone... just hima Ef Wyatt Greenmen Not sure what the teary face is for! Omega J LaRue 9 andi Like - 13h 2 іке like- 4d Ox? Like · 14 o Rene Martin Murillo 9-10 Tony Rocha 43 о 2 1 Е Tai Toki-Rogers 11, the boy next door. We were at it until | turned wa Joe Skelly 11 Like · 1d Like - 1d 17 1 А о > Like · 1d 3 K Like - 1d » 1 bill; Richard Surles Jr 14 Ellas Abilama 22 №. Jose 5 Hernandez DAMN | Was The Neighborhood Slut Like · 1d Like - 1d m William Jones Ten year old Can't Even Remember My Age о 1 | Was In Grade School LOL Garret Coleman | was 10 Jere Douglas 8 Eee Like - 1d 1 2 Like · 1d © Like - 1d E James Beaton 11 өй Mason Wagoner 17 Carl m] 2 Eee ESS) cu" Like - 1d ; Like - 1d Like 14 Е Clint McKellar 22 < o: LE] Ole AHemness 7 Keith Boswell 22 Sebastian Alex 24 oiii Lie - td Like - td Like - 1d & уд Albert Hoffman 6 David Leh 12 Michael n a. renee Like - 4d : Like - 1а Like - 1d E] Anthony Vito Raimondi 16 with a classmate к Vaibhav Dhariwal 15 Like - 1d David Aird 21 Doug Bowers 22 Like - 1d Like 14 Like - 1d A Josh Becker 12 Bi 1 Flint Ternes 14 Like - 1d Like 14 o Ken Dunning 11/12 1 Like - 1d David Edgar 14 5 ? Like - 1d Jan Rejfek | had always dick 25 Richard Brown 16 Like - 1d 2 Michael Gee 14 Like - 1d Like - 1d Like - 1d Robert Ledwell 12 Like · 1d Mario Andre Quiroz 15 Jonathan Goeldner 12, with a friend doing an overnight Like - 1d Oo: Like - 1d Michael Booth 6 but first full on man to man sex when | knew what | JOUET wanted was at 16 lost my anal virginity at a tender age of 48 Chadwick Gray 10. With my best friends brother next door. He was 12 at the time. Like - td Like - 1d Os: ©? Like - 1d М сааи James Long Townsend 14 Шке · 1d 4 Michael Morejon 10. Like · 1d a о 1 Like - 14 Willem Marais 16 Randy Frazer 12yo Like · 1d e Jeffrey Todd Ollom 13 Like - 1d ID 21 Like - 1d Colin De Jongh us Jeff Kendall 45 Like - 1d Michael Fellenz 9 От Like 1d Like 1d Hugh Grant 23 ish Like - 1d Jerry Calderon 16 Lee Hamilton 14 and loved it Like · 1d Like - 1d Luke а те John Рашк 15 Like · 1d Mark A Geraghty 12 but it wasn't consent Like - 1d Like - 1d Жы? Tony Kaplan 18 my step brother Timothy Saathoff 13 with my best friend Like - 1d B eM: Chris McGaughey 10 in showers after p.e B mE: X€zmoMEUmseu s»mGgHY3»» Ó3»"m:gus-eor he oe eee a AMANRNAR Like - 1d Qo? Like - 1d Mickey Braden 12 Ref Cagle-Foster 7 : Like - 1d Larry Avi Lucas Macias 15 and it was Hugh and hut &3 2, Fred Lewis 14 Like - 1d - Edited — Like - 1d RL Adams Last week! 92 @ Like - 1d о ы Lee Mcallister good lord so many of you where so young ,, те | was 19 Like - 1d o: Gerald Shockley 14 Like - 1d Craig Pennison 14 after school Darwin Israel 15 ШІ Ken Leedham Lee Mcallister | was 12 and loved every moment Like · 1d Like - 1d Like - 23h СА "S Jackson Stivers 13 Ryan Koch-Cate 23 Like - 1d Like - 1d Elvar Jakobsson 16 Like · 1d Randy Friedman 18 Brian OBrien 15 Like - 1d Like - 1d Ed Gary Poole Don't remember. The neighbor boys and | played naked it our tree fort a lot. One older boy like to be tied up and spanked. | think | lived in a kinky wooded suburb looking back on it. mom ERES Zziul E.A. Sabol Consenting, | was 11. Without my consent, | was a Joseph James Brennan 12. Haven't stopped since toddler. Tome 02: Like - 1d Like - 1d LEE 55 zz aEGENMOSO: нсана A Chris Nevins 4th or 5th grade! 9 or 10 Steve Nolan 15 or so. 1st cousin about 2 years older broke me in. Wilfred D Tremblay 13 1 Like - 1d Like - 1d o Like - 1d Paul Breakiron Gave my first blow job at 16......it was with consent Уш George Hughes 14. Buti was raised in midtown Manhattan. ES Dennis Benson Depends - willingly ~ 15. Like - 1d Like - 4d Like - td o: ЕЕ Jamie Solomon Paul Breakiron your very sexy ғ Eddie Hughes 11. Gave ту 1st blow job to a neighborhood best Ы Ben Bristow 13 Like - 1d тета o: Like - 4d Like - 1d Billy White 7 " id Charles Randall 10 — zh David Hopkins 24 зерт 1 Like - 1d Bryon Juarez 13, my Cousin ші Bishop Andrew 16 Like - 1d By Benjamin DeLee 8 ike O82 Like - 1d Like - 1d Anderson M. Christopher 12 а Raven Oh 17 Ж John Каре Benjamin DeLee really!? Like 1d Like · 1d Like - 1d Kerry Chapman 3rd grade m Stephen Robinson 22 but I'm tied with McDonald's now... over a regen BN Benjamin DeLee indeed Billion served ike Like · 23h Like - 1d - Edited Os : Lou Gonzales Yesterday y Like - 1d Os Wilfred D Tremblay 13 J Charles Michaelson 14. A few weeks after | lost my virginity to my Like - 1d then girlfriend Samuel Vanwert 11 | was a early bloomer loved it then love it now Like - 1d and I'm 63 E Dennis Benson Depends - willingly — 15. Like · 1d Q: Like - 1а o: ә John Paver 9 Ken Irvine 12 or 13. Like - 1d Like - 23h Mike Harrison 5 years old haven't stopped yet am 63 now is Tony Englefield 9 Like 1а оё: teu O: A William Hugh Moultrie 12 Irving Smith Convertino 16 Like - 1d Like - 23h ІН Glenn Monte Mike Harrison that's sad 1:4) Alex Panagopoulos 13 Like - 23h T o: Е Edward Cichocki 9 Jose 255 8. Like 1d Like - 23h ГЕ | Mike Harrison Glenn Monte | know it wasn't а good thing but 4, Michael Wilshinsky 14 really did want it and liked it i Q: Like - 1d ) Terrell Cleland 14 Monte Miller 15 Like 23Һ А Like · 1d Like - 23h " 5 Danny Douglas 26 | | Rene Ortiz Mike Harrison me too. | was really bad. Год — 1 = Michael Hubbard 9 James Arnold 7 ыды Like - 1d Like - 23h : TS ille 18.1 Th SUN ЕН Ж Parker Раш 16, but if we're counting being molested 4 rev Summerville 18. In a sauna. The guy was al sucke 4 Victor Rietveld 10 him off and spat it out. then he sucked me and swallowed the lot. Like - 1d 2 Е? Daniel Huffman 18 Ы > Never saw him again Like - 1d Like - 23h ob Lilly Parker Paul Like - 1d 1 Bob Lilly Parker Paul [8 Jim Gallucci 16 Wilton Knight 10 Lee Gunner Was | think 7 or 8 ( dark times ) not given willingly Like - 1d Like - 1d Like - 23h Like - 23h “ р Staash Lazarick First time a guy had MY аск. І was 13. һе was 20 2 Like - 23h Ken Phillips 19 Like · 23h Brad Martin 9 or 10 Like · 23h Russell Elenz 13 and never have know anything other than теп! Like - 23h Manny M. Ж Jeb Montoya 18 Like - 23h Like - 23h a Grover Tesser Manny Velez atta boy 7 14 a Brodie Yg 13 Like · 23h Like - 23h = Rexx Pike 13 Like - 23h m Rick Marion 12 Like - 23h Eddy va ЕЕЕ 2 Like - 23h Ы Grover Tesser Eddy Martinez @xeellentil You needed dick. 4% Like · 23h Edward Wanda Wednesday Sawyer 10 he was 12 Like - 22h о 1 Ronald Akin 24 Like - 22h Edward Costello 14 Like - 22h Mike Davis 4 or 5 ше 2љ ©? Grover Tesser Mike Davis man after my heart. Wish ме had been neighbors sneaking around to share cocks. о: Like - 22h Daimeon Pilcher doesn't mean you weren't molested. A 5 year old isn't expected to fully know wrong from right and the person you were with took advantage of that. От Like - 22h Grover Tesser Serious dick with cum 9 He was older. Played p p at 6 with chums of same age. OB: Like - 23h E Bob Lilly Grover Tesser oops!!! Did not mean angry!!! Sorry. Like - 23h Grover Tesser Bob Lilly No problem if you did mean it. | was having a great time. 7%” О: Like - 23h Bob Lilly Grover Tesser no didn't mean ІШІ | was having fun then 100!!! Шке: 1d Kelly Paris Grover, how old was the guy you had fun with when you were 9? Like 14 Grover Tesser Bob Lilly if guys are honest..]| bet 87% of us. o5 Like 14 ЖІ Bob Lilly Grover Tesser so ітие! | really enjoyed ІШІ 1 Like- 1d Thomas Farley 12 1 Like - 23h George Dominguez 9 1 Like - 22h Darrell Moore 12 Like - 22h Like - 22h Shawn P Murphy 13 2 Like - 22h Antonio Miguel Spinoza Following, 13 Like - 22h B Spencer Richards | was 18 the first time | had a man cock От © Bob A. RaNeses 21, college buddy Like - 22h 56 EY Jimmy Brindle | was 15 1 Like - 23h о Е Kirt Schellhaas 23 e: Robert Brown 10 Like - 23h 2 Like - 23h Jacks Von Liria 14 Charlie Junke 13 Like · 23h Like - 23h Craig Warner 13 Samuel Bojorquez 12 Like - 23h V Ai - & Е e e Like - 23h David Mellinger 20 Philip Smith 8 Like - 23h Like - 23h Scott Masters 16 Like - 23h Adam Walder Probably around 13 Like - 23h Manny Velez 8 years old BJ LaRouech 11 2 1 Like - 23h Like - 1d о Lary Wayne Wadsworth 7 Q? Like - 23h Michael Gordon 5 Like - 23h B Michael Gordon ves От Like - 23h E Michael Gordon | always was gay no women here Like - 23h Richard Barragan 5 years old 2$: Like - 23h Perry Hummer 12 Like - 23h Jaime PB 21 Like - 23h Allan Spach 12 Like - 23h Michael Greck 13 Like - 23h | ШІ ^ Jim Martin 11 Like - 21h Danny Dupree 6 neighbor friend Like - 21h o: а Grover Теѕѕег Danny Dupree yes Danny. And what a beautiful name. It just feels good in mouth and even better when it rolls past my lips. Great name buddy. 9) Like - 21h Alex Ray 11 Q 1 Like - 21h Guy D Broome 5 Like - 21h Michael Edwards 12 Os: Like - 20h [^3 Jaycee Hammer Did your older brother top you? Like - 20h Scott Coleman Michael Edwards me tool 4 2 & Like - 20h Michael Edwards Jaycee Hammer no Like - 20h Rodney Davis 15 Like · 20h Steven Rees 13 years old Like - 20h Harry Orama | was very young 5ish 6.it was my uncle, | thought you had to be with men, | did like it, one of my favorite role model was "speed racer” | remember one time kissing the t.v cartoon character and my mom saw me and she's like, no you don't do that, | was like really , but i love this man mom, well at least in my mind | told her, but i was. smart, | start it doing behind her back! Hehe The time | was with a woman was back in 1985, never looked back ! О: Like - 20h Joseph Bernard Snyder 6 yrs old Like - 19h : Brandon Perez Emnace Id never fucked but oral, | do at 9. Only oral up until now, but never fucked a guy. Like - 19h - Edited Scott Carpenter 11 © 8 Mickey W. Kean 15 Christopher James Shipp Touched my uncles cock when | was 5! Had sex when | was 19 Оё: Like - 21h - Edited E Bob Lilly Christopher James Shipp he never said anything? Like - 21h Patrick M Kearns 18yrs Like - 21h Erik S Malm 30 Like - 21h Damien Ruud 21 Like - 21h o : Anthony Alleycat Fióre 15 Like · 21h Jeff T Huckaby 10, the 14 year old boy across the street... and the 11 year old boy on the corner. Sleepevers galore with the three of us. Good times. Lots of frottage and touching. От Like - 21h Edited Dean Davis 6 Like - 21h o: Dan Gerrell 9 ©) 2 Like - 20h [1 Dan Gerrell No need to cry, it was with an 11 y/o and boys were boys... shit Magnum PI changed my life before that happened... Lol ғ Like - 18h - Edited Alec Edwin Porter 7-8 к ei Like - 20h Ey Edward Paul Alec Edwin Porter same Like · 19h ЁЙ Steve Steffen Edward Paul , thats too bad, soo not right Like - 19h Patt Copeland-Griggs 16 Like - 20h Brad Diffenderfer 13, my brothers BFF. Off and on for 2-3 years. Like - 19h Nightwolfe Lockwood-Park 6 E ет Like · 19h Tony King-Watkins Oral 8, anal 16 Like - 21h o: E Bob Lilly Tony King-Watkins who at 8? Like · 21h Bi Tony King-Watkins Bob Lilly my 16 year old foster brother Qo: Like · 21h Bob Lilly Tony King-Watkins my 15 year old cousin started me on him at 5. He had me sucking him for many yrs. Untill he got married. Like 21h Tim Harter 15 and have loved it ever since Like · 21h Brandon Coon 12 years old, Boy Scout camping trip. Shared a tent with three other guys. 1 Like - 20h o Scotty Allen 16 Like - 20h Jordan Clevenger My current age, 2122 о: Like - 20h Jack Harrold 14 Like - 20h Douglas OKeeffe Oral 20, anal 21 Like - 20h Michael Dalme 25. | made up for it though lol Like - 20h Greig Shortreed 12 [E Like - 20h Bryan Greeley 15 with a 24 yr old and | thought he was old Like - 20h Marq Kerr 17 didnt like it thought | wasnt gay until | fuck a guy when I was 20 Like · 19h Eddy Cross 4 Like - 19h ШІ Eday cross why the frown face nun? Like - 4m Gary Morse 8 my neighbors son until 11 Like - 19h Like - 18h Ш Don Jones Way before | was a teenager, | don’t even know the Like - 19h Pasquale Valentino 15 СЕ e: x T Brandon Corbitt 8 Like - 19h 83 Scott Smith 9 "al Clint Bordwell 5 ike Like - 48h Like - 18h isch 0) Markus Georg Enders 7 John Paulk 14 Like - 19h С m Merk Jones 16 Like - 18h Mike Allshouse 10 Chris Capps 18 ike Like - 18h Like - 18h Like - 16h Mitch Orr 8 L Sion Corn My own when | was about six ^ — $ Thom Lauth 21 AETA оо 2 Anthony Galvin 8 Kevin Wright 24 Like - 18h Like - 17h Like - 16h i Jeff Osmond 11 1 саша 79 B p Mark Porter | was born with a dick? Like - 19h I eet Like - 18h Р) E Randy Crank-Heflin 18 Like - 18h Like - 17h Е = Like - 16h Jamie Todd YT 10 to suck 13 getting fucked E Dene ataa am OE Like - 19h 02: WHEE EES Like · 18h Troy Duncan In my late 30s ІШІ Like - 18h 5 Like - 17h igs Like - 16h Mark Dwayne Turberville Jr. 13 Stephen Jackson 11 L5] dp ke] Paul Holbrook 13 ike Arthur Silver 12 Eie don Like · 17h FN ii Like - 16h Heath NaughTeeboy Tanner 9 with my older brother and then 11 Scott Clink 15 ЕҢ Philip J Morganti 8 with my 23 year old neighbor. Still play with brother on occasion. Yup Like - 17h 11 Robert Dulworth 12 I'm a total pig! Like - 17h Like - 16h Оза: [3 Ben Rice 21 Like - 16h Like - 14h A Stacy Sanders Burge 13. a Chris Resto à Б Heath NaughTeeboy Tanner Dont be sad....i pursued them Like - 17h when I ned iyoo not tie oiher way сола became ап (ЖШ Jeremiah Miller 11 Like - 12h escort at 14 and loves it. Now at prefer to be a one man e pig. | dont enjoy multiple partners any more. Like: 14h ы Б eves к Раш Winchester Five Like - 7h Uter A Like - 12h LE Daemon Nushi 7, some random in a toilet. He picked me up, split me in 2 and held me close as he pounded my hole. Will never forget him Like - 15h Steven Miller 26 Siler Wesley 9 and lov Like - 14h Patrick Eaton 11 yo, played with cousin same age Like 14h Michael Vinci 9...was molested by a 70 year old man! A z Like - 15h Like - 14h Allen Ray Feeman | had to be about 15. us John Geraghty 12 ж Christopher Lonkey 7 Like - 15h Like - 11h Like - 8h 42: Ricky A Lenart 22 David Mott 5 9D з M] Grover Tesser Christopher Lockey БЕНЕН Like · 15h Like - 11h Like - 8h ! 57 [4 Joey Spriggs Paul Winchester 5 Like - 6h Anthony Payne 16 Like - 12h Brian Petersen 29 Like - 12h Paul Bryan 13 Like - 12h Randy S. Kidwell 14. My brothers От Like - 11h David Keith Duffey 14 Like - 15h Larry Cotton Markee Kershner 8th grade Like - 15h Travis Finn 7 1 Like 6h Grover Tesser Travis Finn hope itwas consensual. If it was my hat is tipped to you buddy. Like - 6h Travis Finn Grover Tesser It was totally consensual and started off as touching and progressed from there. @ Grover Tesser David Мо Like - 11h Mark Orman 3rd grade Like - 8h «2 5 a Grover Tesser Mark Orman m Like - 8h Like · 5h However I Love it now ! Like · 4h Grover Tesser Ron Boatriont [hope tnat it was consensual: If so my hat is tipped off to you. | knew | was fascinated by crotches at 3. Played with a couple of cousins at 6. Had my first dick with cum at 9. High school boy. He turned me on to a couple of his horny friends. Loved suckin their cocks. Ron Boatwright Grover Tesser no it wasn't | was a baby. © 1 ? Michael Browne Young Les Wright 8 from my cousinin the Army m Like - 9h Leston Buell 19 maybe? ғ Like - 9h David Douglas Smith 9 Like - 9h Like 5h Mark Andrew Priest 12 L2 e: Like - 5h el Buddy Reeder 12 ru Like - 5h Q: Like - 11h Like - 10h Michael Benjamin 12 or 13 Like - 10h Frank Lopez About 6 or 7. Like - 10h е : Perry Hummer 12 Like · 7h Rick Schneiter 15 Like - 7h Ken Harrison 12 1 Like - 6h Aurthur King 12 1 Like - 6h Q' ізі Carlos Р Glinzman-Murphy 9 or 10 Like - 3h О: Grover Tesser Travis Finn | put out signals and innuendo. Sure they were older. But nobody was lurking in the bushes offering me candy to suck their cocks. Grover Tesser Ron Boatwright bless you buddy. Thank my. оџ are a survivor. Men and cocks and cum, not to mention balls and an ass to eat are the best things in life. Maybe too much to question but | am interested. Do you feel your very early experience swayed your sexuality? | was born Mark Jump Sr 8 , old man neighbor made me kiss him and fondle him, but loved playing with my same age friends, then in my teens my older brother friends would come over while my brother was away and lay naked on me humping and a lot of frottage, | loved it, then | tried to live a straight life until my early fifties started with cock again at 51, now I'm 61 and still can't get enough, want it all the time едо: gay. Have never been with a woman. Lucky to have had the most understanding parents in the world from the get-go. Like - 5h ғ. Like - 3h Like - 3h Doug Reiss Depends on what way.... first time someone had mine (in a way) | was 14. Went home with someone at age 18. Got very Larry Laura Grey Dees 7 and I'd do it all over again «25: Alex Vázquez 17 От Joe Robinson 15 Like - 2h Like - 1h Gregory D. Felten 12 Like - 4h Sick afterwards (and | know why). œ 1Reply Ll Chadley Dunn 13. It was awesome. He got me into my fetish for Like - 2h o: ma guys with a hairy ass and uncut dick 7 MEL беле аз” Like - 3h еэ m Jerry McCumber 177i think! Hot contractor Ryan Logan 12 1 te m % 1Repy Like - 2h o Like-th 4! 5% Robert Buhrow ШЕ William Bonilla | һауе my own dick since birth A Lance Hilmer 14 Michael J Keith 14 Like - 4h Like - 3h O2: Like - 2h Like - 1h : N Nelson Gonzalez About 8 % 3Replies E Matt Wesson About 12 Rich IE 14 Like - 4h ө?ғ: i ; Eddie Pabon 5 Like · 1h Like - 1h œ 1Reply Like - 3h Оз > = ШЕ Alex MacLeod Matt Wesson 1291 Е meta КВ Егіс Nudelman too old * 3Replies Like - 28m Like - 52m @DO 4 - ike m Like - 3h - Edited 68 Levi Scott LeMay Way too young & no regrets 7 " 5 Rick AndRock | was 10 and my friend was 11. | was his first and he Ф 2Replies Like - 2h was my first. We messed around for a couple years just playing but А this опе night we took it all the way and yes | felt him when he came. Charles Hutton 20 jim Todd Michael Kepus 16 He said he felt me too. We messed around for about 10 more years рит — then we lost touch ike Like - 1h - Edited Osa’ Michael Petersen 17 Like - 2h Ф Like - 1h Jim Williams 16 first | sucked him then he bent me over and shoved itin. He was 44 Оза: Brett James Still Waiting €5 29 Like · 27m Like · 52m Manuel Pico 16 Р а ы Rod Раш Andrés Jim, | was 16 when | got involved with а 36 year old. Knocked on his door, he invited me in. One thing led to another and | ended up being passed around to three others through the evening. Like - 17m Skip VandeLinde 5 42: Like - 51m о: Like - 46m Like · 26m Ruby Morales 12, with my neighbor and best friend who was also 12 for a summer then we moved and | did not have anything until | bottomed at 18. That was awesome. Haven't had any since. | am bi and happily married to a woman. Оз: Frank Abbott 18 year old Like - 25m В Jason Clark Hmmm. Consenusally about 12. Mileages proably 4 or 5 Manuel Pico | let them Catch me Os: Like - 41m Like - 25m Luis Hernandez 5 3 Grover Tesser Manuel Pico well somet] something. GRIN Like - 18m Like - 40m Fernando Roura | was underage LE 58 d Tim J. Stieg About 13 maybe. Maybe 14 Like - 17m Like - 35m 58 What is Comet Pingpong known for? Why is the Rom-show for “All Ages”? P sashalordpresents joshuaryanv Comet Ping Pong » P UJ@L “Т Т! i Comet Ping Pong \sasHa e] à | PRESENTS fÑ oct ober 28, 2016 canes ping pong 25 likes ;astanya ,% $ iS 59 | FOLLOW Why is the symbol for pedophilia in the shape of a worm? It gets worse. 5. POLITICS аар How often should humans be treated for parasites? PARASITE-MARE Surgeons pull dozens [at least once per year] day How often are Americans treated for parasites? of ‘WRITHING’ parasitic worms from [Never] boy’s tummy after he became constipated Gemma Mullin 10 Jun 2019, 15:47 | Updated: 10 Jun 2019, 17:33 American pets are given access to low-cost, over-the- с а counter anti-parasite medication that has no known side-effects in humans. A FOUR-year-old boy had dozens of parasitic worms removed from his Yet American humans are not put on regular parasite- | P99v after he complained of feeling constipated. treatment schedules. Stomach-churning images from the operating room showed a metal bowl filled with the "writhing" creatures. Reconcile. Can parasites lobotomize their host? [poor memory and thinking skills] Parasite >>> Infected Host >>> Poor Critical Thinking Poor Critical Thinking + Mass Media = Control Voters The 'bundle of live worms' in a metal bowl after being removed from the boy's What is the [real] reason Americans do not have small intestine Credit: BMC recommended parasite-treatment schedules? The four-year-old boy lying on the operating table during surgery Credit: BMC 'Bundles of worms' The team, led by Dr Valirie Ndip Agbor, extracted the "bundles of live worms" through a small incision in the boy's intestine. Doctors said if the worms had not been removed they could have led to malnutrition, physical growth problems and poor memory and thinking It gets worse. skills. He hadn't been "dewormed" since birth - 55:619215 ЕЗ to clear off adult worms and their eggs from the bowel. 60 Can parasites mind control their hosts? Parasites Practicing Mind Control AUG. 28, 2014 An unassuming single-celled organism called Toxoplasma gondii is one of the most successful parasites on Earth, infecting an estimated 11 = percent of Americans and perhaps Carl Zimmer half of all people worldwide. It’s just eU РНИ? as prevalent in many other species of mammals and birds. In a recent study in Ohio, scientists found the parasite in three-quarters of the white-tailed % * deer they studied. » One reason for Toxoplasma's success is its ability to manipulate its hosts. The parasite can influence their behavior, so much so that hosts can a put themselves at risk of death. Scientists first discovered this strange A microscopic cyst in the brain of a mouse containing thousands of Toxoplasma gondii mind control in the 1990s, but it’s parasites. New research has found that the parasite is able to exert a form of mind control by turning its host's genes on and off. Jitenc S.D.A F«Fnrnm H been hard to figure out how they manage it. Now a new study suggests that Toxoplasma can turn its host's enes on and off — and it's possible other parasites use this strategy, The Atlantic SCIENCE Neuro-parasitology is an emerging E ^ Я Parasites Can Mind- branch of science that deals with A е : Қ parasites that can control the nervous er x» "Re ; Control Animals system of the host. ... Іп some of the most : 4 САТУ АУМ 22 Without Infecting fascinating manipulations, the parasite Ж, 3 АЛЫР Them taps into the host brain neuronal circuities ib қ to manipulate hosts cognitive functions. ч 2 : In 2018, everything is a metaphor. 1 May 2018 By Ed Yong ® https://wwwrontiersin.org » full Mind Control: How Parasites Manipulate Cognitive Functions in ... Can humans be controlled by a parasite? A kingfisher catching a stickleback (Nigel "We're never ever going to be allowed to do that with humans." In a lab setting, Toxoplasma also binds to dopamine receptors, which are the brain's reward centers. "It's quite possible and plausible that if you have an agent affecting dopamine, it could influence people's behaviors," Adamo says. 7Dsg 2012 61 https://www.discovermagazine.com/planet-earth/meet-the-parasites-that-control-human-brains Meet the Parasites That Control Human Brains Toxoplasma, brain-infecting amoebas, rabies and more. By Ben Thomas | Oct 29, 2015 9:00 AM News > Medscape Medical News Common Parasite Now Tied to Impaired Cognitive Function Batya Swift Yasgur, MA, LSW . July 22, 2021 The macabre world of mind-controlling parasites roscience Articos | August 25, 2019 Summary: Understanding how parasites ‘hack’ the brains of their hosts may provide new insights into decision making and behavior. Log In Source: Frontiers Username Imagine a parasite that makes an animal change its habits, guard the parasite’s offspring or even commit suicide. While mind-control may sound like something out of Password a science fiction movie, the phenomenon is very real — and has spawned a new field, neuro-parasitology. As outlined in an article published in Frontiers in Psychology, Remember Me understanding how parasites “hack” their host's nervous system to achieve a particular goal could provide new insights into how animals control their own behavior and make Create decisions. Mind Control: How Parasites Manipulate Cognitive Functions in Their Insect Hosts Wi Frederic Libersat“, F Maayan Kaiser and E. Stav Emanuel Department of Life Sciences and Zlotowski Center for Neurosciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel Neuro-parasitology is an emerging branch of science that deals with parasites that can control the nervous system of the host. It offers the possibility of discovering how one species (the parasite) modifies a particular neural network, and thus particular behaviors, of another At least now you know what he is talking about: LINK 62 Are parasites used to mind control high-profile targets? [political power, financial power, military power] Would this behavior be considered ‘normal’ or ‘hacked’? LINK1 LINK2 Are high-profile targets sent to special luncheons and dinners? What is put into the food? Who is spikethechef? What is Comet Pizza? Who is this? Are ‘hacked’ targets easy to control? What are (((handlers)))? Parasite hacks and then lobotomizes host. Host's power transfers to (((Handlers))). Vote Red? Vote Blue? Either way, Power >>> (((Handlers))) Are mentally ill individuals suitable for public service? Are mentally ill individuals suitable for leadership roles? Are mentally ill individuals suitable for promotion in the military? Mental illness or brain-parasite? What if he/she/they/them are purposely infected due to position of power? What if he/she/they/them are promoted and given more power because they are infected? It gets worse. 64 Can parasites take complete control over a host? LINK Can controlled hosts infiltrate into high-level government organizations? Once in position, can controlled hosts pass legislation which supports the spread of parasites? Would this result in directing scientific funding away from parasite treatments? Would this result in outlawing Fenbendazole while also mandating Glyphosate? Can these high-level controlled hosts work to include Polysorbate-80 and aluminum in vaccines? Can these high-level controlled hosts work to mandate these vaccines? What happens to the career of medical doctors who suggests something that goes against recommendations of the WHO or CDC? LINK Why make every effort to ensure that humans are infected by parasites? [the end goal of a parasite is not to kill the host, but to spread more parasites] When a person of influence does something which goes against common sense, we assume he has been bribed, black-mailed, threatened... [Wrong] [Wrong] [Wrong] He has been infected. Is a controlled host still aware of the actions he performs? Does a controlled host still feel remorse and guilt, but is unable to stop himself from obeying the parasite? Does this cause a controlled host to wish he could die, but the host is still unable to kill himself? [R9.6] What is the [real] reason suicide rates are so high in the infected? Who is this? What were his beliefs in 1960? His beliefs in 1961? In 1962? 1963? 1964? 1965? 1966? [MOST loyal adherent] Did his beliefs suddenly change in 1967? Did he just suddenly decide to 'change his mind'? OR was his mind changed for him? Are parasites biological? What are biological weapons? 65 What is biowarfare? Are parasites biological? Can parasites be used as weapons? Can parasites mind control their hosts? US Commerce Dept says China has brain-control weaponry Academy of Military Medical Sciences lands on the Entity List for its role, along with 36 other orgs Laura Dobberstein Fri 17 Dec 2021 // 07:02 UTC 5402 The USA has added another 37 organizations - 34 of them from China — to its list of businesses with which US interests can't interact without a license, with a» 12 of them earning their places for developing "mind control weapons." As usual, the newly listed organisations earned their place on the grounds their activities represent a threat to national security. Less usually, this batch sees plenty barred for bodgy biotech. Did the US have a biolab in Lyme, Connecticut, which specialized in tick-borne illnesses? How did Lyme disease get its name? What insect causes Lyme disease? Why did the CDC cover up Lyme disease for 45 years? Is Lyme disease caused by a parasite [bioweapon]? Have US operatives worked to cover up the cause of other parasitic diseases? Is Alzheimer’s caused by a parasite [bioweapon]? 'Two decades of Alzheimer's research was based on deliberate fraud by 2 scientists that has cost billions of dollars and millions of lives Recommended Countless lives destroyed, billions of dollars lost, so many families torn apart... ...and all just to protect their precious bioweapons. 66 To protect their precious bioweapons, would they suppress information about other treatments? What is Covid19? What is hydroxychloroquine [HCQ]? 15 НСО effective against Covid19? 15 НСО effective against parasites? Did a high-level political figure [45] recently suggest mass-use of HCQ? 15 НСО safe to use in the short-term to treat illness? Is HCQ even safe to use in the long-term? @ lupus.org/news/safety-of-long-term-use-of-hydroxychloroquine-therapy-further-verified-for-people-with-lupus LU 2US Understanding Lupus Living ' FOUNDATION OF AMERICA News February 14, 2019 Safety of Long term use of Hydroxychloroquine Therapy Further Verified for People with Lupus Hydroxychloroquine (Plaquenil®) was approved by the Food and Drug Administration for symptoms of lupus. The greatest concern people with lupus have when taking hydroxychloroquine is related to vision and an increase in risk for retinal damage. A new investigation analyzed the retinal changes over a five-year period in people with lupus and did not find clinically relevant retinal changes in the group. The study concludes that hydroxychloroquine therapy is use at doses «5 mg/kg/day. Learn about how lupus affects the eyes and hydroxychloroquine. What effect might a massive application of HCQ have on a population being manipulated by parasites? Would NPCs begin to heal? Would NPCS begin to regain use of logic and reasoning? Death knell to (((those in control)))? How might (((those in control))) react to such a situation? DJ Patriot Billionaire pharmaceutical company founder Barry and his wife Honey Sherman were murdered in their Craig "Sawman" Sawyer ™ ind Toronto home on Dec. 15, 2017. @CraigRSawyer They owned Apotex, a manufacturer of generic drugs, specifically HYDROXYCHLOROQUINE. ‘Unexplained’ Explosion Destroys World's Second They manufactured the drug. Largest Hydroxychloroquine Raw Material Factory = = ~\ DrBill @DrBill_ MD. | am a licensed physician in Utah. | tried to prescribe P» hydroxychloroquine but the | | l pharmacist said the state had taken over the distribution of the “Unexplained” Explosion Destroys World's Second Largest Hydroxychloroquine R... "A Well, 2020 is refusing to go out without a bang. Literally. An "unexplained" drug. Even though I'm licensed, | explosion just destroyed the world's second largest hydroxychloroquine raw ... cannot prescribe it. This is & welovetrump.com WRONG! 2:04 PM . Dec 23, 2020 - Twitter for iPh , Р ИЧЕ ii i ы 1:10 PM - 4/5/20 - Twitter for iPhone Did hydroxychloroquine suddenly become a "life threatening" drug and its use must be immediately banned? So many different articles written by so many different authors, yet such similar wording: The largest-yet survey of using a Trump-touted z Study find EECA om a malaria drug t ес as coronavirus cure (f) Oregonian in COVID-19 patients treated with malaria drug hydroxychloroquine: study Chicago Tribune | 2 hours ago ars he malaria drug wi ted by President Donald howed no benefit in а A malaria dr no benefit 'ans hospitals. The: he en hydroxychloroquine v reported. The nationw More deaths, no benefitffrom malaria drug in VA virus study AP Associated Press | 7h а study was not a ri Delayed death certificates interrupting municipal benefits, union leaders say 4 More Deaths, No Benefit ату Beast | 5 hours ago obtain death 'ontinued health ident Donald Trump for ved no benefit in a large 'ans hospitals. There A malaria drug w ificates that enable the ge and other benefits, асс о death certificates right treating the new coronav ho Yem to secure analy f its use in U.S. v more deaths COVID-19 treatment hydroxychloroquine showed{no benefi: more deathdin МА virus study Ш Fox News | 2 no Malaria arge study c d ury at a very high can Study findq more deaths, no benefitffrom malaria drug touted by President Trump T кноу 14 wing по benefits to patients with Hydroxychloroquine test in VA study ЕШ Merc g ed no benefit in a spitals an А malaria drug say ous experiment NEW: Study shows[no benefitfrom drug touted by Trump in virus fight El Агата Jou ituti Study finds|more coronavirus deaths, no benefit from malaria drug touted by Trump A malaria dr dent Donald Trump for treating th ed no benefit in a a E: 1 Philadelphia 1 analysis of it hospitals. There Е А malaria dr t by Pr nt Donald Tr г more death: ia dru by President D d Trump fo standard care. ^ ү туге қ TR Study shows[more deaths, no benefit]ffrom Coronavirus updates ШЕ malaria drug touted by Trump from NBC News Raleigh № ФА NBC News| 2h hydroxychloroquine v treating analysis of its more deaths amon a rigorous experiment. Drug championed by Trump for coronavirus awaiting validation x Я 37 : oe ‹ ynoa d treatment s y - An ana s Talking Points Memo A malaria drug v g the ni udy " Coronavirus study]More deaths, по benefitffrom ited by p out an antibiotic for COVID-19. More deaths, no benefitffrom malaria drug No benefit, more deaths]Hydroxychloroquine Touted by Trump, coronavirus study finds lops in VÀ hospitals study T Tampa Bay Times | 1 hou Ш washington 7 A malaria drug үйде more deaths amc standard care, re: But witi 368 pati not a rigorous experiment. | More deaths, no Бепей тот malaria drug hydroxychloroquine in VA coronavirus study 5 % The Boston е |5 Veterans With COVID-19 Given Trump-Touted Hydroxychloroquine Showed|No Beneta] Study Finds hloroquine ve: n a retrospective study. which has not yet b mined patient Hydroxychloroguine as treatment for COVID-19 showqno benefit and more dearhs[in VA study W MarketWatch | 5 А malaria drug resident Donald Tru ias " President Ti AVA coronavirus study finds Қ” IU potential breakthro hydroxychloroquine results i ^ і j analysis of its us: d no benefit in a treating the n Salt Lake Tribune | 2 ho by President Donald Trump for ed no benefit in a large Thi A malaria treating the virus sh analysis of its и more deaths a ‘Ivermectin: FDA approved drug with over д billion doses administered worldwide, named on W.H.0's List of Essential Medicines and won their Why did the media never report on the following: LINK inventors the Nobel Prize in Medicine in 2015" (((Who))) controls the media? Was there are similar response to Ivermectin? Why did Mass Media run a smear campaign to convince the public that Ivermectin was just horse-paste? Why did the media never report on the following: LINK ((Who))) [really] controls the media? r- hOrSe DeWoRMEr ана It gets worse. 68 What did the CIA mean by this? "Telergons play an important role in the interrelationships of the Organism with its environment, since by means of them the animal can exert diverse actions on other organisms which are located within its Immediate surroundings and which are involved in the combination of its conditions of existence. One telergon serves the animal as protection against enemies, another -- for immobilizing prey, a = -- for oe nut 1%) » 8 Sanitized - Approved For Release : CIA-RDP82-00141R000100290001-2 The article points out that the term in question is purely physio- logical and encompasses substances of very diverse chemical composition; telergons can be proteins, steroids, alcohols, organic acids, etc. Gen- erally, Kirshenblat subdivides telergons into the following categories: A. Honotelergons -- substances which act on other members of the same species 1. Gonofions, which cause formation of or changes in sex charac- teristics 2. Gamofions, which stimulate maturation of sex glands and re- productive processes 3. Epagons which attract other members of the same species -- substances which act on animals of other species Progaptouns, which immobilize or kill prey Aminons, which protect animals from enemies Likhneumons, which are elaborated by Myrmecophils and termi- ophis and expectorated by ants or termites, on which they e-sġimulating or narcotic effect Google Scholar хепадопѕ Articles Any time Your search - xenagons - did not match any articles. Since 2021 Since 2020 Suggestions: Since 2017 Make sure all words are spelled correctly. Custom range... Try different keywords. Try more general keywords. Sort by relevance Try your query on the entire web Sort by date Why are they covering up information about xenagons and parasites? [Maintain control by any means necessary] 69 Can bioweapons be used to perform covert political assassinations with plausible deniability? Are political assassinations performed using 'cancer'? Who is Bill Oxley? Or are political assassinations performed using ‘parasites that cause cancer’? @ researchgate.net/publication/7889939 Pathogenic significance of a-N-acetylgalactosaminidase activity found in the hemagglutinin of influenza virus Is a-N-acetylgalactosaminidase the key to curing cancer? A mini-review and hypothesis Article Nov 2017 - J BUON @ Ehsan Saburi - € Jalil Tavakkol Afshari - Sajjad Biglari . Yousef Mortazavi View Show abstract ... Evidence also shows changes in the GalNAc components of the extracellular matrix and extracellular membrane attachment component such as integrins in cancer tissues or cells (16,17). These findings confirm that the presence of Nagalase in many pathogens such as bacteria, parasites and viruses may be effective in their spreading in the body (15,18, 19). One of the most important role of Nagalase has been investigated in macrophage suppression (20). ... Does aerobic glycolysis of the parasites deplete nearby host cells of oxygen? Does oxygen depletion result in localized cells being forced into the fermentation-mode of ATP generation? If those cells are locked into fermentation-mode of ATP generation, would this result in a rapidly growing tumor which would soon be destroyed by the body's immune system? What if the body's immune system is unable to detect the rapidly growing tumor? What is Nagalase? The so-called “Nagalase” is an endogenous enzyme that plays a role in sugar metabolism. The scientifically correct name is “N-acetyl- Galactosaminidase". Nagalase can split off certain sugar molecules , namely N - acetyl- galactosamine , from large molecules. Specifically, Nagalase may split off the N- acetyl galactosamine sugar side chain from the so-called “vitamin D - binding protein” (“DBP”). DBP is found in serum and is also referred to as ^Gc-Protein". Yamamoto and colleagues reported that tumors can produce Nagalase ( Yamamoto et al. 2008a , 2008b , 2008c , Reddi et al. , 2000). Moreover they reported that in tumor patients Nagalase serum levels mabe increased. There is evidence that the Nagalase produced by tumors has an “immuno- suppressive” effect: It is thought that the Nagalse-mediated immune-suppression in cancer patients contributes to the growth of the existing tumor and the formation of metastases. Do parasites produce Nagalase to hide from the body's immune system? Does the immunosuppressive effect of Nagalase also prevent the body from locating and removing the abnormally and rapidly growing cells which have been locked into fermentation-mode by parasites which are consuming all localized sugars? Parasites >>> Force Cells into Fermentation >>> Results in rapidly dividing cells >>> Nagalase >>> Cancer 70 Stages of Parasite infection: Parasites infect local tissues [Stage 1} Rapid Parasite growth >>> Parasites burrow deeply into local tissues [Stage 2] Parasites protect themselves by infecting/damaging lymph nodes [Stage 3] Parasites get into blood stream and spread to other parts of body — metastaic [Stage 4] No active parasites but inactive parasite larva which may activate years later [Remission] What other common disease has 4 stages and a remission state? [Cancer] Parasites >>> Consume local sugars Lack of sugars >>> Force Cells into Fermentation-mode of ATP generation Prolonged Fermentation-mode >>> Uncontrolled, rapid cell-division Parasites release Nagalase to hide from Host’s immune system Nagalase >>> Also hides local cells which are rapidly dividing .. rapidly dividing Do parasites cause cancer? LINK Did a parasite cause your cancer? 18 June 2017 Four common cancers linked to infections In a research study (Lancet Oncology May 2008) using IARC data, researchers found four common infections linked to a large number of cancers: Human papillomaviruses (HPV), Helicobacter pylori, and hepatitis B and C link to 1.9 million cases of cancer. While the study reports that these infections are rarer in developed countries, air travel makes everybody vulnerable. "Infections with certain viruses, bacteria and parasites are some of the biggest and preventable causes of cancer worldwide," said Catherine de Martel and Martyn Plummer, who led the study. Cervical cancer accounted for about half of the infection-related cancers that occurred in women, and liver and stomach cancers accounted for more than 80 per cent of the cases in men. The term 'parasites' can include parasites themselves (these do not have to be a meter long but can be microbial), viruses, bacteria and yeasts. About 17 per cent of cancers are known to be caused by parasites, the real figure could be even higher, while in some cancers, yeasts are recognized to be a potential problem during modern orthodox treatments. nonymous (ID: CESAM) = 08/26/22(Fri)23:40:14 No.392743850 » 22392742877 It's more the "by products" of infestation that the body can't isolate, but yes cancer is parasites. Cleveland Clinic is about the only place in the US that treats parasites. They used to have an article on their website about parasites and breast cancer. They took it down. They studied my friend's case and even came out to visit her and talk to her doctors. Woman's brain tumor turns out to be parasite growing in her head A parasite in the brain sounds like the plot of a horror movie, but it's a preventable infection from tapeworm that can be found in pork. Reminder: are parasites sexually transmitted? Define 'routine close contact'? Oral Sex and the Alarming Rise of HPV- Related Throat Cancer in Men By 2020, the rates of HPV-related oropharyngeal cancer are expected to surpass those of cervical cancer. So why aren't young men getting vaccinated? By Kimberly Lawson A 3D imaging "fly through" shows the location of Rachel Palma's brain lesion. қайнатады We May 29, 2019, 11:48 AM EDT / Source: TODAY By A. Pawlowski Rachel Palma’s symptoms were strange and disturbing: She was having hallucinations, insomnia and “horrific nightmares.” Her right hand would suddenly give way and she’d drop things. She was having trouble finding the right words and made alarming phone sofisrael.com/f ungus is telltale cancer sign, possibly screenable by blood test: Israel-US study Many tumors are teeming with fungi that shed DNA into blood, and researchers say blood analysis could offer treasure trove of information to detect and to shape treatment calls to her family that she didn't remember. “My episodes were getting more and more bizarre ШВВВРА lives in Middletown, New York, told TODAY. “There were days that I didn’t know where I was.” a cdc.gov/media/releases/2015/p1104-parasite-tumors.html Hunting for fungus in the human body may offer a brand-new method for early detection of cancer, Israeli scientists suggest in new peer-reviewed research. Scientists at the Centers for Disease Control and Prevention have discovered cancer cells originating in a common tapeworm may take root in people with weakened immune systems, causing cancer-like tumors. It is the first known case of a person becoming Working with colleagues in the US, they studied tumors from 17,000 cancer patients to document, for the first time, which fungi live in the tissue. ill from cancer cells that arose in a parasite - in this case, Hymenolepis nana, the dwarf tapeworm. There has been very limited research until now on fungi in tumors, and scientists had assumed that its occurrence was rare. "We were surprised to find that it's actually more common to find tumors with fungi than without,” said Dr. Ilana Livyatan of the Weizmann Institute of Science. The report, in the Nov. 5 issue of the New England Journal of Medicine, raises concern that other similar cases, if they occur, may be misdiagnosed as human cancer - especially in less developed countries where this tapeworm and immune-system-suppressing illnesses like HIV are widespread. "We were amazed when we found this new type of disease - tapeworms growing inside a person essentially getting cancer that spreads to the person, causing tumors," said Atis Muehlenbachs, M.D., Ph.D., staff pathologist in CDC's Infectious Diseases Pathology Branch (IDPB) and lead author of the study. "We think this type of event is rare. However, this tapeworm is found worldwide and millions of people globally suffer from conditions like HIV that weaken their immune system. So there may be more cases that are unrecognized. It's definitely an area that deserves more study." 72 Is it statistically significant that 100% of lung cancer patients are associated with parasites? Ш ncbi.nim.nih.gov/pmc/articles/PMC6536861/ High frequency of infection oflung cancer patients with the parasite Toxoplasma gondii Jaroslav Bajnok,! Muyassar Tarabulsi,! Helen Carlin, Kevin Bown,’ Thomas Southworth,? Josiah Dungwa,? Dave Singh,? Zhao-Rong Lun,'3 Lucy Smyth, and Geoff Ніде! к Author information > Article notes > Copyright and License information Disclaimer Methods Lung tissue samples were taken from patients undergoing lung resection surgery (n=72) for suspected lung cancer (infection prevalence 100% (95% CI: 93.9-100%)). All 72 participants were confirmed as having lung cancer following subsequent diagnostic tests. In addition, bronchial biopsy samples were collected from non-lung cancer healthy control subjects (n=10). Samples were tested for T. gondii using PCR amplification of T. gondii specific gene markers and T. gondii specific immunohistochemistry. Results EPA ee lem oem oases! with T. gondii (prevalence 100% (95% CI: 93.9-100%)). Of which, 95.8% (n=69) of patients showed evidence of active parasite stages. Infection prevalence in the controls (10%) was significantly lower (p<0.0001). @ cancer.org/healthy/cancer-causes/infectious-agents/infections-that-can-lead-to-cancer/parasites.html Parasites that Can Lead to Пр Cancer A Society Certain parasitic worms that can live inside the human body can also raise the risk of developing some kinds of cancer. These organisms are not found in the United States, but they can be a concern for people who live in or travel to other parts of the world. Opisthorchis viverrini and Clonorchis sinensis are liver flukes (a type of flatworm) that have been linked to increased risk of developing cancer of the bile ducts. The bile ducts are tubes that connect the liver to the intestines. These infections come from eating raw or undercooked freshwater fish. They occur mostly in East Asia and are rare in other parts of the world. Fungi grow inside cancerous tumors, scientists discover Schistosoma haematobium is a parasite found in the water of some countries in the Middle © Live Science - 5h Q East, Africa, and Asia. Infection with this parasite (an illness called schistosomiasis) has been linked to bladder cancer. Possible links to other types of cancer are now being studied as well. 73 If parasites cause cancer, would anti-parasite medications be effective against cancer? LINK ё pubmed.ncbi.nlm.nih.gov/31375107/ Ivermectin inhibits canine mammary tumor growth by regulating cell cycle progression and WNT signaling 1 2 Hongxiu Diao ', Nan Cheng |, Ying Zhao 1, Huihao Хи ', Haodi Dong ', Douglas Н Thamm Di Zhang 3, Degui Lin 4 Affiliations + expand PMID: 31375107 PMCID: PMC6679554 DOI: 10.1186/512917-019-2026-2 Free PMC article Abstract Background: Mammary gland tumor is the most common spontaneous tumor in intact female dogs, and its poor prognosis remains a clinical challenge. Ivermectin, a well-known anti-parasitic agent, has been implicated as a potential anticancer agent in various types of human cancer. However, there are no reports evaluating the antitumor effects of ivermectin in canine mammary tumor. Here, we investigated whether ivermectin was able to inhibit canine mammary tumor development and explored the related mechanisms. Results: Ivermectin inhibited the growth of canine mammary tumor cell lines іп a dose- and time- dependent manner. The antitumor effects induced by ivermectin were associated with cell cycle arrest at G1 phase via down-regulation of CDK4 and cyclin D1 expression, with no significant induction of apoptosis. Furthermore, significantly reduced B-catenin nuclear translocation was observed after treatment with ivermectin, resulting in the inactivation of WNT signaling. Consistent with the results in vitro, a significant suppression of tumor growth by ivermectin was observed in canine mammary tumor xenografts. Conclusion: Ivermectin, as a promising anti-cancer agent, inhibits the growth of canine mammary tumor by regulating cell cycle progression and WNT signaling. The Benzimidazole-Based Anthelmintic Parbendazole: A Repurposed Drug Candidate That Synergizes with Gemcitabine in Pancreatic Cancer /?022c 28386 ё pubmed.ncbi.nlm.nih.gov/ 621/ Rosalba Florio !, Serena Veschi 1, Viviana di Giacomo 1, Sara Pagotto 2,35 Simone Carradori 1"), Fabio Verginelli 132 Roberto Cirilli *, Adriano Casulli 56, Antonino Grassadonia 22, > Mol Med. 2017 Арг;23:50-56. doi: 10.2119/molmed.2017.00011. Epub 2017 Apr 5. Nicola Tinari 23, Amelia Cataldi 1, Rosa Amoroso 1Ф, Alessandro Cama 1/3" апа Laura De Lellis 1 1 Department of Pharmacy 'Annunzio University of Chieti-Pescara, 66100 Chieti, Italy; rosalba.florio@unich.it (R.F.); veschi@unich.it ( iana.digiacomo@unich. it (V.d.G.); Repurposing Mebendazole as a Replacement for Vincristine for the Treatment of Brain Tumors e cement sis amelia.cataldi&unich.it (A.C.); rosa.amoroso&unich.it (R.A.); Department of Medical, Oral and Biotechnological Sciences, G. d' Annunzio University of Chieti-Pescara, 66100 Chieti, Italy; sara.pagotto@unich .it (S.P); antonino.grassadonia@unich it (A.G.); nicola.tinari@unich.it (N.T.) Center for Advanced Studies and Technology (CAST), University “С. d'Annunzio" of Chieti-Pescara, 66100 Chieti, Italy Centro nazionale per il controllo e la valutazione dei farmaci, Istituto Superiore di Sanità, 00161 Rome, Italy; К roberto.cirilli@iss.it Affiliations + expand 5 WHO Collaborating Centre for the Epidemiology, Detection and Control of Cystic and Alveolar PMID: 28386621 PMCID: PMC5403762 DOI: 10.2119/molmed.2017.00011 Echinococcosis fn Animals and Humans), Istituto Superiore di Sanità (ISS), 00161 Rome, Italy; adriano.casulli@iss.it Free PMC article European Union Reference Laboratory for Parasites, Istituto Superiore di Sanità (ISS), 00161 Rome, Italy Correspondence: simone.carradori@uni alessandro.cama@unich.it (A.C.); Tel.: +39-0871-3554583 (5.С.); +39-0871- 559 (А.С.) 1, Caitlin Powell ' 154 Michelle De Witt 1, Alexander Gamble 2, Derek Hanson 2, Daniel Markowitz Saleh Al Dimassi 1, Mark Atlas 3 4, John Boockvar 1 2 ^, Rosamaria Ruggieri 24 Marc Symons ! 2 Abstract Received: 26 November 2019; Accepted: 14 December 2019; Published: 17 December 2019 е, лы The microtubule inhibitor vincristine is currently used to treat a variety of brain tumors, including low- grade glioma and anaplastic oligodendroglioma. Vincristine, however, does not penetrate well into brain tumor tissue, and moreover, it displays dose-limiting toxicities, including peripheral neuropathy. Mebendazole, a Food and Drug Administration-approved anthelmintic drug with a favorable safety profile, has recently been shown to display strong therapeutic efficacy in animal models of both glioma and medulloblastoma. Importantly, appropriate formulations of mebendazole yield therapeutically effective concentrations in the brain. Mebendazole has been shown to inhibit microtubule formation, but it is not known whether its potency against tumor cells is mediated by this inhibitory effect. To investigate this, we examined the effects of mebendazole on GL261 glioblastoma cell viability, microtubule polymerization and metaphase arrest, and found that the effective concentrations to inhibit these functions are very similar. In addition, using mebendazole as a seed for the National Cancer Institute (NCI) COMPARE program revealed that the top-scoring drugs were highly enriched in microtubule-targeting drugs. Taken together, these results indicate that the cell toxicity of mebendazole is indeed caused by inhibiting microtubule formation. We also compared the therapeutic efficacy of mebendazole and vincristine against GL261 orthotopic tumors. We found that mebendazole showed a significant increase in animal survival time, whereas vincristine, even at a dose close to its maximum tolerated dose, failed to show any efficacy. In conclusion Т 3757177 upport the clinical use of mebendazole as a replacement for vincristine for the treatment of brain 74 Q & pubmed.ncbi.nlm.nih.gov/31181622/ Benzimidazoles Downregulate Mdm2 and MdmX and Activate p53 in MdmX Overexpressing Tumor Cells Zuzana Mrkvová !, Stjepan Uldrijan 2 3 Antonio Pombinho *, Petr Bartůněk 5, Iva Slaninová 6 Affiliations + expand PMID: 31181622 PMCID: PMC6600429 DOI: 10.3390/molecules24112152 Free PMC article Abstract Tumor suppressor p53 is mutated in about 50% of cancers. Most malignant melanomas carry wild- type p53, but p53 activity is often inhibited due to overexpression of its negative regulators Mdm2 or MdmxX. We performed high throughput screening of 2448 compounds on A375 cells carrying p53 activity luciferase reporter construct to reveal compounds that promote p53 activity in melanoma. Albendazole and fenbendazole, two approved and commonly used benzimidazole anthelmintics, stimulated p53 activity and were selected for further studies. The protein levels of p53 and p21 increased upon the treatment with albendazole and fenbendazole, indicating activation of the p53- p21 pathway, while the levels of Mdm2 апа МатХ decreased in melanoma and breast cancer cells overexpressing these proteins. We also observed a reduction of cell viability and changes of cellular morphology corresponding to mitotic catastrophe, i.e.. G2/M cell cycle arrest of large multinucleated cells with disrupted microtubules. In summary, we established a new tool for testing the impact of small molecule compounds on the activity of p53 and used it to identify the action of benzimidazoles in melanoma cells. The drugs promoted the stability and transcriptional activity of wild-type p53 via downregulation of its negative regulators Mdm2 and МатХ in cells overexpressing these proteins. The results indicate the potential for repurposing the benzimidazole anthelmintics for the treatment of cancers overexpressing p53 negative regulators. Pharmacol Res. 2021 Jan; 163: 105207. PMCID: PMC7505114 Published online 2020 Sep 21. doi: 10.1016/j.phrs.2020.105207 PMID: 32971268 Ivermectin, a potential anticancer drug derived from an antiparasitic drug Mingyang Тапо,20.ї Xiaodong Hu, ^ Yi Wang, Xin Yao,24 Wei Zhang,2” Chenying Yu,2» Fuying Cheng,®> Jiangyan 11,24 and Qiang Fang? 4e" Am J Cancer Res. 2018; 8(2): 317-331. PMCID: PMC5835698 Published online 2018 Feb 1. PMID: 29511601 The multitargeted drug ivermectin: from an antiparasitic agent to a repositioned cancer drug Mandy Juarez, Alejandro Schcolnik-Cabrera,' and Alfonso Duefias-Gonzalez? Ivermectin converts cold tumors hot and synergizes with immune checkpoint blockade for treatment of breast cancer Dobrin Draganov, Zhen Han, Aamir Rana, Nitasha Bennett, Darrell J. Irvine & Peter P. Lee npj Breast Cancer 7, Article number: 22 (2021) | Cite this article Why are anti-parasitic purgatives such as Ayuahuasca or San Pendro effective against cancer and depression? Do parasites cause depression? Do parasites cause cancer? What would happen to the symptoms if the cause is removed? 75 - е @ ourworldindata.org/cancer Сапсег аны by Max Roser and Hannah Ritchie This article was first published in July 2015; updated in April 2018 with latest cancer data for the year 2017 - and revised substantially in November 2019. © Reuse ourworkfreely Cite this research In 2017, 9.6 million people are estimated to have died from the various forms of cancer. Every sixth death іп the world is due to cancer, making it the second leading cause of death - second only to cardiovascular diseases.* Cancer is the second leading cause of death in the world. What is the first? Are certain cardiovascular diseases caused by parasites? What is Dirofilaria immitis? -Heart Disease 23% of total deaths -Cancer = 21% of total deaths Both causes draw direct links to parasites. Yet there is still no regular schedule for parasite treatment in humans. No treatment, despite links to 44% of total deaths world-wide. 70,000 deaths EVERY DAY can be linked to parasites. Still no treatment schedule. More deaths every day than American soldiers died during the entire Vietnam War. Still no treatment schedule. If 70,000 lives could be saved every day with a $1/day parasite treatment, would the entire world be placed onto a parasite-treatment schedule? What if 99% of the world population was infected? What if people discovered the information in this document? Would the truth put 99% of people in the hospital? [142] What effect would world-wide routine parasite treatments have? [Host no longer transfers power to (((Handlers)))] [Voters no longer easily swayed by Mass-media assets] What would happen to (((their))) system of control? [Maintain control by any means necessary] What happens to those who discover evidence of this? 76 The world's top anti-virus microbiologists are being killed off. By 2005, 40 were dead. Today, over 100. Many murdered, the rest died under very suspicious circumstances. It is known they were all working on highly sensitive or government-funded research projects tied to bio-weapons and viral pandemics. Are these silenced ‘whistleblowers’ who knew too much? Why isn't the mainstream media reporting on this story? Why do doctors who discover the link between parasites and cancer always commit suicide? LINK [Maintain control by any means necessary] 77 Is there a link between parasites and viruses? Why are antiparasitic medications also anti-viral? а, о А world of viruses nested within parasites: Unraveling viral diversity within parasitic flatworms (Platyhelminthes) West Nile virusXartificially coloured) can invade the central nervous system more easily in the-presence of parasitic worms. Credit: Science VU, Visuals Unlimited/Science Photo December 2021 DOI:10.1101/2021.12.15.472606 Abstract Because parasites have an inextricable relationship with their host, they have the potential to serve as viral reservoirs or facilitate virus host-shifts. Yet, little is known about viruses infecting parasitic hosts except for blood-feeding arthropods that are well-known vectors of zoonotic viruses. Herein we uncover viruses of flatworms (Phylum Platyhelminthes, group Neodermata) that specialize in parasitizing vertebrates and their ancestral free-living relatives. We discovered 115 novel viral sequences, including 1 in Macrostomorpha, 5 in Polycladida, 44 in Tricladida, 1 in Monogenea, 15 in Cestoda and 49 in Trematoda, through data mining. The majority of newly identified viruses constitute novel families or genera. Phylogenetic analyses show that the virome of flatworms changed dramatically during the transition of Neodermatans to a parasitic lifestyle. Most Neodermatan viruses seem to co-diversify with their host , with the exception of rhabdoviruses which may switch host more often, based on phylogenetic relationships. Neodermatan rhabodviruses also have an ancestral position to vertebrate-associated viruses, including Lyssaviruses, suggesting that vertebrate rhabdoviruses emerged from a flatworm rhabdovirus in a parasitized host. This study reveals an extensive diversity of viruses in Platyhelminthes and highlights the need to evaluate the role of viral infection in flatworm-associated diseases. 78 Do parasites build viruses? (You): B-But if Parasites cause the flu, where do Viruses come fro- The Parasite-Pill Correspondingly, much attention has been paid to the “excretory-secretory” (ES) antigens of helminths, a pragmatic approach to collect mixtures of released proteins that dates back over How PARASITES evade the 60 years [9]. Much more recently, of course, the application of genomics, transcriptomics and mass spectrometry has transformed our understanding of these complex and heterogeneous | ттипе Syste m preparations by defining the individual molecular components that parasites release to modify their environment [2]. As discussed below, these products are not only proteins, but also include glycans, lipids and nucleic acids, in particular miRNAs, as well as small molecules and metabolites, and are released in a variety of “packages”, including lipid vesicles. — ee Қыл АН Шаң - Genetic material Nucleic Acids v (ОМА ог RNA) miRNA wal М Capsid — Protein [V] Typical Virus Makeup < Typically 50-250 nm in diameter ANY QU ESTIONS? Link: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008435/ Asexual reproduction in the intermediate host [ edit] Inside host cells, the tachyzoites replicate inside specialized vacuoles (called the parasitophorous vacuoles) created during parasitic entry into the сей,25123-39 Tachyzoites multiply inside this vacuole via the bloodstream to all organs and tissues of the body, inclüding the brain ^? ^"^ Tachyzoites: LINK What are Exosomes? LINK [cellular communication network] Do parasites build viruses to hijack the host's communication network between cells? By hijacking communications, can the parasite manipulate the host's cells into serving the parasite? LINK Do viruses cause disease, or do parasites cause viruses? Does a cough transmit infectious viruses or does it transmit infectious parasites which then produce viruses? Are viruses a disease or a symptom? Why are anti-parasite medications [really] considered to be anti-viral? Do the anti-parasite medications cure the disease, and thereby also relieve the symptoms [viruses]? What is Pleomorphism? LINK Born out of healthy cells? ...Or unseen parasite larva hatching due to the newly created acidic environment? 79 O Anonymous (ID: 6ІШ ШЕТ) = 09/28/21(Тие)17:21:15 No.341303196 p> >>341303668 >>341303773 >>341304532 22341287338 No, parasites use hormones and various other chemicals to alter the host behavior. They get into your body but they don't get into your DNA. m Anonymous (ID: 4GWMIESA») = 09/28/21(Tue)17:32:20 No.341304532 » >>341304963 22341303196 they use epigenetics, bro Anonym (ID 8) = 09/28/21(Tue)17:35:35 No.341304963 >>341305834 File: BBF4CO5F- ТЕСВ4 AF15-8(...).jpg (192 KB, 1200x2029) >>341304532 >they use epigenetics, bro Interesting. How, exactly? You got any sauce? CJ] Anonymous (ID: €GVAMIEBAD) == 09/28/21 (Tue)17:42:15 No.341305834 » >>341304963 https://www.sciencedirect.com/science/article/abs/pii/S092544392 1001472 parasite pill makes too much sense. Do parasites use viruses to manipulate a host’s DNA through epigenetics? @ news-medical.net/news/20200825/Advances-in-Virus-Epigenetics.aspx How can a virus use epigenetic cofactors to dysregulate cellular pathways and help control its life cycle? There has been growing evidence that viruses exploit epigenetic processes in order to control their life cycles. The role epigenetics plays in the regulation of viral infections is not yet fully elucidated and the epigenetic regulation of viral gene expression has only recently begun to emerge. Epigenetic regulation during viral infections is usually bidirectional. Virus will use host cellular factors for transcription or replication and epigenetic cofactors such as histone acetylases, deacetylases, methylases, and demethylases in the control of its life cycle. Viral pathogens have been shown to epigenetically dysregulate cellular pathways in order to optimize their own transcription or replication or evade the cells innate immune response. For many virus types, nuclear persistence is dependent on genome chromatisation, where virus DNA associates with core histone proteins, forming episomes during latent infection. Integrating viruses such as retroviruses and lentiviruses insert their DNA into host genomes, facilitating histone associations so that the viral chromatin is then subject to histone modifications. This viral epigenome, like the host cell machinery, has significant impact on viral gene expression and replication. 80 Viruses of parasites as actors іп the parasite-host relationship: A " ménage à trois" Amaranta Gómez-Arreaza ! , Anne-Lise Haenni 2, Irene Dunia ?, Luisana Avilán 4 Affiliations 4- expand PMID: 27876650 DOI: 10.1016/J.actatropica.2016.11.028 Abstract The complex parasite-host relationship involves multiple mechanisms. Moreover, parasites infected by viruses modify this relationship adding more complexity to the system that now comprises three partners. Viruses infecting parasites were described several decades ago. However, until recently little was known about the viruses involved and their impact on the resulting disease caused to the hosts. To clarify this situation, we have concentrated on parasitic diseases caused to humans and on how virus-infected parasites could alter the symptoms inflicted on the human host. It is clear that the effect caused to the human host depends on the virus and on the parasite it has infected. Consequently, the review is divided as follows: Viruses with a possible effect on the virulence of the parasite. This section reviews pertinent articles showing that infection of parasites by viruses might increase the detrimental effect of the tandem virus-parasite on the human host (hypervirulence) or decrease virulence of the parasite (hypovirulence). Parasites as vectors affecting the transmission of viruses, In some cases, the virus-infected parasite might facilitate the transfer of the virus to the human host. Parasites harboring viruses with unidentified effects on their host. In spite of recently renewed interest in parasites in connection with their viruses, there still remains a number of cases in which the effect of the virus of a given parasite on the human host remains ambiguous. The triangular relationship between the virus, the parasite and the host, and the modulation of the pathogenicity and virulence of the parasites by viruses should be taken into account in the rationale of fighting against parasites. Once you understand that these "viruses" are fabricated mental constructs to explain away the actions of parasites to keep us chasing our tails, you'll understand that PARASITES are the mRNA editors. The longer they remain active in your system, the more likely you are to One in a million (or whatever it is) of those mRNA edits fails to get deleted by your body's fail safe, RNA polymerase, which is theoretically supposed to catch mutations or gene damage to mRNA and delete them before they become DNA. With parasites, the mRNA edits are so frequent, that it becomes inevitable that some changes will make it past the gatekeeper. This is especially problematic for the vaccinated people. The number of edits they'll experience is in the billions, nonymous (10. ) ШЕ 09/26/21 (Sun)17:00:46 Мо.341002 have a degree in microbiology. AIDS is casued by the CHAGAS parasite, trypanosoma Cruzi. HIV was a theoretical construct they used to hide the truth, never isolated based on computer modeling, with Anthony Fauci running cover-up while people like Nobel prize-winning Kary Mullis, who invented the PCR test, spent their career trying to expose Fauci's lies and blow the whistle on the AIDS scam only to be mysteriously murdered just before the launch of COVID, which is modified T. Cruzi. The particles they look at & call "viruses" are stress proteins created by a body that's either infected with parasites or exposed to toxins. They are exosomes, not viruses. It's merely the correlation fallacy. They're not causative. T. Cruzi causes AIDS in EVERY animal. Of course they call it immune dysfunction, immunopathology, etc Chagas causes macrophage derangement -https://pubmed.ncbi.nlm.nih.gov/9464791 T. Cruzi causes autoimmune disease that causes heart disease https;//pubmed.ncbi.nlm.nih gov/25521296/ https://pubmed ncbi.nim.nih.gov/21734249/ Chagas and auto-immunity https://pubmed ncbi.nlm.nih.gov/22951533/ Chagas causes auto-immunity in chickens https://pubmed ncbi.nlm.nih.gov/16323421/ Chagas causes immune dysfunction by mimicking other toxins/pathogens (& carrying heavy metals on it's surface) to fool your immune system https:/Awww.ncbi.nim.nih.gov/pmc/articles/PMC5823355/ All parasites are https://pubmed ncbi.nim.nih.gov/29211102/ Sexual transmission of Chagas is an ordinary eve https:/www.longdom.org/open-access/trypanosoma-cruzi-and-domestic-animals-2327-5073-1000e142 pdf 100 million people are exposed yearly in Latin America, alone, making it the MOSt prevalent STD in the world. nonymous (ID ) ЕН 09/26/21(Sun)17:05:39 Мо.341003512 жисіе Г ona (21 KB, 720x198) All the species of trypanosoma are given different names based on the host they аге found in. But every species is cross contagious with every other host. IE, if you take the chicken version and put itin a human, it will follow the same life cycle as if it сате from a shellfish or cow. The indestructible eggs (oocys з identical in every species, along with the larval form otes. The adult form chang nding on the host, like the alien face hugger changing slightly depending on it's host. They call the disease v Dourine in horses. In reality, it's all the same species, structurally and morphologically identical. It's a multi-trillion dollar cover-up that allows Big AG is Broad resistant callie hel wort ie o окота cl бекті KNOW: https://link springer com/chapter/10.1007/978-94-011-9034-3_ 36 Anonymous (ID: ) /26/21 )17:02:42 3 3112 » Рап 2 Т. Cruzi is EVERYWHERE, іп ай mammals, birds, & shellfish, found in 80% of randomly tested guinea pigs https:/www.ncbi.nim.nih.gov/pmc/articles/PMC46: raccoons, 77% of Argenti ats https-//pubmed.ncbi.nIm.nih.gov/3237 1222) 40% of wild pigs, 44% of Italian bats, 80% of chickens. It's the #1 cause of heart failure- І found in this МІН. ed article that | had to use the WayBack Machine to locate https://www.researchgate.net/publication/326591340 Prevention and Control of An Overview Mosquitos, triatome beetles, ticks, fleas, biting flies, are all vectors, but by my estimation account for less than 10% of the spread. Most outbreaks are linked to contaminated food https;//www.elsevier.es/en-revista-medicina-clinica-english-edition—462-articulo-orally. transmitted-chagas-disease-S2387020617300992 and contaminated beverages https://pubmed.ncbi.nim.nih.gov/32781335/ & then sexual transmission is right up there. This is the most versatile pathogen every to exist, yet the official dogmatic narrative is that it's rare, non sexually transmitted, (despite being found in the semen of every animal tested) and only spread by a single beetle. Nothing to see here. The plot thickens inonymous (ID: ) EB 09/26/21(Sun)17:06:52 No.341003675 > Part 4 Pretending all our problems are caused by secondary infections of viruses and bacteria instead of parasites allows Big Pharma to generate trillions by treating the second symptoms of infection that arise with immuno-compromise. Most people will live with it for 50+ years and never get rid of it. It doesn't kill you. It just weakens you & when you get old and weak it causes secondary infections that kill you. 90% of tests will yield false negatives, so it's VERY difficult to detect. Most cases are identified post mortum by autoopsy. Or by biopsy of lymph nodes, which only shows positive if you are in stage 3 of infeciton. This problem is compounded by the fact that doctors are trained to believe that it's exceedingly rare, and they'll try to steer you away from parasites if you bring it up, owing to their demonic Rockefeller indoctrination combined with their narcissistic personality profiles, which are a prereq for acceptance into the medical programs. The boards all know, as do the people who write the textbooks. All the books have been written for the express purpose of covering this up, along with the role that other parasites play, causing 60-80% of human health problems. Why would every government agency deny it's sexual transmissivity? Why haven't they done tests on US cattle to determine the prevalence on farms? Why do they continue to gaslight us and pretend that a beetle is the only vectors, a beetle which probably accounts for less than 1% of the spread? inonymous (ID: ) EB 09/26/21(Sun)17:08:21 Мо.341003849 » Part 5: How do | know CO uzi? Covid strips iron off hemoglobin, much like the parasite malaria. This is a very complex task that requires the production of enzymes to digest the alpha chains, enzymes are larger and mort mplex than a virus. The virus is analagous to a knife. The enzyme inalogous to a bomb. A parasite is analogous to a factory. A virus would have no reason or ability to do this. Parasites like Chagas, on the other hand, are known to strip iron to use iron to hyper accelerate their growth. Both Сома and Chagas cause macorphage confusion, CD4 dysfui on, and the re: 5 endocarditis as the macrophages target the ACI ptors of € that have 51 spike 5 in them (a problem made much worse with the vaccine). Coronavirus and HIV are the ONLY pathogens that contain s1 spike protein, a 4 letter 2quence patented by F г (which has 70 CCP members on the board) in 1 t ence. The the same base thing, though COVID has been gain of functioned SIGNIFICANTLY. Covid long-haul syndrome 15 extremely similar to the AIDS progression. It's uncanny. The reason ADE reactions occur is that the anti-viral antibodies that you body produces post vaccine don't stick to parasites, so they end up circulating and causing acidic damage to every organ instead. The CV19 version s s able to survive on dry surfaces for days instead of minutes, a major change, but otherwise it's pretty much the same progression nonymous (10. ) ЕН 09/26/21(Sun)17:09:39 No.341004008 » Part 6: So after | figured this all out, the biggest cove-up of all time; that parasites are the main plague we face, | went searching on the chans to see if anyone else had realized it, and | found the mother of all red pills, the thing that Q has been prepping us to accept. The final lesson. You aren't ready for this unless you've already accepted that 1) The media is a coordinated lying campaign 2) The 3 letter agencies are evil gatekeepers 3) The western medical establishment cares nothing for human life 4) There is a systemic attempt to destroy society & freedom оп a global scale by collectivist ideologies 5) The elites are blood drinking child raping monsters pushing degeneracy on the population for a sinister purpose. Behold, the answer the all the riddles: THE РАКА: Dr. Fauci claimed that , mig e í by “routine clos contact.’ (May 5, 198 Association). (Mich What could possibly go wrong: — __ “мЛегееуегуопе has HIV: 5 "XN 'We want to challenge l'oronto pop-upis the first of its kind anywhere, and was born out of a recent poll suggesting many still fear sharing food with someone HIV positive We all have tapeworm stages in our bodies, probably going back to childhood when we ate dirt. It is not normal for these stages to hatch and develop further. Their purpose is to stay dormant. And perhaps they do little harm this way. But I have found that all HIV/AIDS sufferers have "tapeworm disease". The stages are hatching. This spews the tiny larvae and cysts, plus unfertilized eggs and their bacteria all over the body, making you feel sick. Perhaps the large amounts of solvents accumulated in the body forces them to hatch; perhaps the lowered immunity allows them to hatch. This work remains, unequivocally, the most important thing I’ve ever written. It attempts merely to synthesize the efforts of DRASTIC and numerous other independent researchers with whom I’ve collaborated directly [the left-hand column below], as well as the outstanding research of those scientists who've fought against the censorship and false narratives that obscured their findings: Jonathan Couey Fernando Castro-Chavez Johanna Deinert Angus Dalgleish Simon Wain-Hobson Richard Fleming Kevin McCairn Luc Montagnier Rossana Segreto Jean-Claude Perez Ah Khan Syed [pseud] Steven Quay Jack Ward [pseud] Birger Sorenson Dayou Zhang My findings and conclusions on scientific censorship are based on several thousand hours of individual research. The findings related to the HIV inserts in general, gp120, the furin cleavage site and other aspects of the SARS-CoV-2 genome are the product of those listed above, or others referenced in the endnotes. The implications are profound, and profoundly disturbing; the scale of the response to the first draft and livestream has clearly shown me that my intuition about their importance was correct. I’ve published them here, now, because the evidence has become so overwhelming that I can’t, in good conscience, withhold these conclusions from the public. In short: Dr. Fauci & others knew, based upon the suspicious elements of the SARS-CoV-2 genome, that the virus had almost certainly been manipulated They knew that such manipulations likely came from pseudovirus & insertion techniques very familiar to US & Chinese viral vaccine & therapeutic/ МСМ programs They immediately took steps to censor and control public & scientific discussions related to the HIV inserts and FCS, respectively; these actions are more properly viewed as obstruction of justice This had major implications for both the early response to the pandemic [FCS] and the long-term impact on global public health [the HIV inserts and ‘Long COVID' sequelae] Without hesitation, 1 would testify under oath to the veracity of the evidence in support of these conclusions. They involve implications that are horrific regardless of which scientists, from which country, may have been responsible for creating SARS-CoV-2. I propose the list of questions that follows on behalf of the victims of the COVID-19 pandemic, who cannot ask them themselves. I promise you, however, that all of them are waiting to hear the answers. Semper Fidelis. A Charles H. Rixey HIV >>> t.cruzi Is Covid19 an airborne parasite [bioweapon]? 83 CDS:surface glycopro 65 N H5 Y EG DI P IG A 6 CASS v OT Query MET CEA FTGGTSCAGGTATATGCGE TAGTTATCAGACT | | | LiL Sbjct ACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTC CDS:surface glycopro NW SY E € 0 T P IG AG IC AS V9 T CDS:surface glycopro ЖР У А 5 QS І ТА ҮТ Query TH THERE EET HIT TTT Mitt yt TTGCCTACACTA | | | 005 | | | Sbjct LDA CREE Gate AC AGIGTAGCTAGTCAATCCATCATTGCCTACACTA CDS:surface glycopro Д Q NaSi P- RGR A EVA SQSIIAYT CDS:surface glycopro MS LGAENS VAY S NN TA DP T Query TGTCACTTGGTGCAGAAAATTEAGTTGCTTACTCTABTAACTCTATTGCCATACCCACAA | | Ш | | Sbjct TGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAA CDS:surface glycopro M LG A E NS VÀ X SH OAS: TA IP Т CDS:surface glycopro 717 D 5 WT Е Be VS. БОЛ Т.М Query 237 ТОНИНИ ШІ ШІ ТІН | | | Sbjct 237 ATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAG CDS:surface glycopro 717 N D m wy E #5 MTkKkT1Swv Now, this is really interesting because not only have we seen that the QTNS section is derived from HIV but there is something very special about the adjacent PRRAR because that is a furin cleavage site and as we have seen, these don't exist in this type of SARS-like virus. It's an insertion to the viral genome, but nobody really knows how it got there (just like the HIV sequences). In order to see where it came from we need to look outside the amino acid It's easy enough to change a single nucleotide (a single point mutation or SNP) or even insert or delete nucleotides (less common) but to insert 20 or 30 nucleotides with a code that works? Nope, that has to come from another virus or else it's been done in a lab. So, where did this code come from? Well it turns out that BLAST can tell us - with some degree of certainty - where some of this code, particularly the bit that codes for the PRRAR section (the furin cleavage site which is so unique), came from. The bit that we are interested in is in the clue from Jikky. CTCCTCGGCGGGCACGTAG. What you see is the same (misclassified SARS-CoV-2) sequences in the first 9 hits, and then none of the remaining hits have 19/19 matches. What this means is that there is no virus known to man that has this particular sequence in its genome prior to the discovery of SARS-Cov-2. So where on earth has it come from? Yes, that's right. Every single one of these patents that contains that 19nt sequence (for which the probability of occurring by random chance is less than 1 in a billion) is from Moderna. In order for that sequence to have arisen in that virus, the virus which was manufactured with its HIV inserts, had to have had been infected into patented cell lines supplied by Moderna that had that unique sequence not seen in any other virus. In theory nothing is impossible in science, medicine or genomics. A SARS virus emerging naturally with 3 HIV inserts at its binding sites and also containing a furin cleavage site that doesn't exist in nature but does exist in a Moderna patent... that's seriously crazy talk. It doesn't exist. A flying pink elephant would be a million times more likely. Апопутоиѕ5 !!902tecpDHQ6 ID:p3uyiz7E Sat 01 Feb 2020 14:46:23 No.241942563 ЗЕ View Report >>241942395 Has anyone started looking into the Parasite angle for the Corona Virus?. Where the "virus" symptoms are just a result of the parasite(s) infesting the hosts?. Very surprised no one has been considering it. Do some lose their sense of smell when they catch Covid? Do some suffer tinnitus when they catch Covid? Can you lose your sense of smell or get tinnitus from nerve damage? Are there nerves from your ears and nose directly connected to your brain? Do parasites seeking the brain utilize the neutral pathways of the nose and ear to access the brain? Blood-brain barrier and retroviral infections Florence Miller, - t- $ Philippe V. Afonso, 2:2 · $: + Antoine Gessain, 2:3 and Pierre-Emmanuel Ceccaldi? 3-4 » Author information + Copyright and License information Disclaimer This article has been cited by other articles in PMC. Abstract Go to: » Homeostasis in the central nervous system (CNS) is maintained by active interfaces between the bloodstream and the brain parenchyma. The blood-brain barrier (BBB) constitutes a selective filter for exchange of water, solutes, nutrients, and controls toxic compounds or pathogens entry. Some parasites, bacteria, and viruses have however developed various CNS invasion strategies, and can bypass the brain barriers. Concerning viruses, these strategies include transport along neural pathways, transcytosis, infection of the brain endothelial cells, breaching of the BBB, and passage of infected- leukocytes. Moreover, neurotropic viruses can alter BBB functions, thus compromising CNS homeostasis. Retroviruses have been associated to human neurological diseases: HIV (human immunodeficiency virus 1) can induce HIV-associated dementia, and HTLV-1 (human T lymphotropic virus 1) is the etiological factor of tropical spastic paraparesis/HTLV-1 associated myelopathy (TSP/HAM). The present review focuses on how the different retroviruses interact with this structure, bypass it and alter its functions. Is lvermectin effective against Covid-19? Why does Ivermectin lose effectiveness after 3 days of Covid-19 infection? Could the Covid [Parasite] gain access to the brain in 3 days by utilizing neural pathways? Does Ivermectin bypass the blood-brain barrier? [N] Is Covid19 a biological weapon caused by a parasite? Accidentally released or intentionally? If intentional, what for what purpose? Is drinking snake venom relatively harmless? What if you inject snake venom? Reconcile. Are airborne pathogens difficult to contain? Are injectable pathogens easy to contain? Reconcile. Was the relatively harmless airborne parasite used to create demand for the injectable one? Which is the [real] bioweapon? 85 UNCLASSIFIED DEFENSE ADVANCED RESEARCH PROJECTS AGENCY 675 NORTH RANDOLPH STREET ARLINGTON, VA 22203-2114 13 Aug 21 From: COMMANDANT OF THE MARINE CORPS FELLOW, DARPA To: INSPECTOR GENERAL Subj: SARS-CoV-2 ORIGINS INVESTIGATION WITH US GOVERNMENT PROGRAM UNDISCLOSED DOCUMENT ANALYSIS Ref:(1) Executive Slide НВ0011850017 EcoHealth Alliance DEFUSE (2) HROO118S0017-PREEMPT-FP-019-PM Summary (Selectable - Not Recommended) (3) PREEMPT Volume 1 no ESS HR0011850017 EcoHealth Alliance DEFUSE (4) PREEMPT Volume 2 EHA Final HR0011850017 EcoHealth Alliance DEFUSE (5) SF424 2 0-V2.0 HR00118S0017 EcoHealth Alliance DEFUSE (6) WIV Budget packet HR001118S0017 EcoHealth Alliance DEFUSE (7) WS00094394-RR KeyPersonExpanded 2 0-У2.0 HR00111850017 EcoHealth Alliance DEFUSE (8) WS00094394-RR PersonalData 1 2-V1.2 HROO1118S0017 EcoHealth Alliance DEFUSE 1. SARS-CoV-2 is an American-created recombinant bat vaccine, or its precursor virus. It was created by an EcoHealth Alliance program at the Wuhan Institute of Virology (WIV), as suggested by the reporting surrounding the lab leak hypothesis. The details of this program have been concealed since the pandemic began. These details can be found in the EcoHealth Alliance proposal response to the DARPA! PREEMPT? program Broad Agency Announcement (BAA) НК0011850017, dated March 2018“! - a document not yet publicly disclosed. The contents of the proposed program are extremely detailed. Peter Daszak lays out step-by-step what the organization intends to do by phase and by location. The primary scientists involved, their roles, and their institutions are indicated. The funding plan for the WIV work is its own document. The reasons why nonpharmaceutical interventions like masks and medical countermeasures like the mRNA vaccines do not work well can be extrapolated from the details. The reasons why the early treatment protocols work as curatives are apparent. SARS-CoV-2's form as it emerged is likely as a precursor, deliberately virulent, humanized recombinant SARSr-CoV that was to be reverse What did Colonel Vladimir Kvachkov mean by this: Can you give us any predictions for the nearest future? In connection to the Coronavirus? Yes. What do you think, which countries could expect pressure next? Russia of course! It's going to be Russia surely. Because for America, Russia isn't an economic competitor. Now the main efforts of the behind-the-scenes world powers are focused on causing disruption in China and Western Europe. And Russia is their target on two accounts: they want to reduce our population numbers and to “cleanse” the territory. That is still to come. Of course, we would like to hear your opinion regarding a practical plan of action, how to act, how to protect oneself, some recommendations. Maybe it's not your field of expertise but maybe you could tell us something. I'm of course, no epidemiologist. Although you could say I'm a parasitologist, because you have to be one in order to understand the power structures in Russia. So speaking as a military doctor, epidemiologist and parasitologist, until we're able to get rid of our internal parasites who rule over us, we won't be able to tackle other parasites. Are There Parasites in the Pfizer "Vaccines"? А 50 micron elongated hody, as seen in Figure 13 is a sharp mysterious presence in the Pfizer vaccine. It appears and is identified anatomically as a Trypanosoma cruzi parasite of which several variants are lethal and is one of many causes of acquired immune deficiency syndrome or AIDS. [Atlas of Human Parasitology, 4th Edition, Lawrence Ash and Thomas Orithel, pages 174 to 178] [9] FOUR PARASITES UNE. wi FOUND IN PFIZER & MODERNA COVID- 19 VACCINES {у Dr. Robert О. Young |ng Media Events Case Studies. Contact Scientific Posts Blog Oa COST Nt OAA AA E E Scanning & Transmission Electron Microscopy Reveals Graphene & Parasites in CoV-19 Vaccines February 5th, 2021 - Updated October 1st, 2021 & March 12th, 2022! Author: Robert [Figure 13 shows a Trypanosoma Parasite approximately 20 microns in length found in the so- called Pfizer “vaccine”. It is composed of carbon, oxygen chromium, sulphur, aluminum, chloride and nitrogen.] https://archive.ph/R16RP Do the vaccinated suffer blood clots? Does venom cause blood clotting? He was correct about the venom: LINK But wrong about the water. From where does the venom actually come? & pubmed.ncbi.nlm.nih.gov/31030034/ Phase Contrast, Dark Field, Bright Field Microscopy, Transmission and Scanning Electron Microscopy and Energy- Review. > Thromb Res. 2019 Jun:178:145-154. doi: 10.1016/;.thromres 201: Dispersive X-ray Spectroscopy Reveal the Poisonous Ep Modulation of the mammalian coagulation system by venoms and other proteins from snakes, arthropods, ‘nematodes and insects AT A Sachetto *, М Mackman Affiliations + expan Parasites found on sterile Covid-19 PMID: 31030034 DOI: 10,1016/j.thromres.2019.04.019 testing swabs: LINK Abstract The mammalian hemostatic system involves complex interactions between protein components of the coagulation cascade and platelets. The fibrinolytic system removes the hemostatic plug. Dysregulation of coagulation or fibrinolyt tems can induce bleeding or thrombosis. Animals, such as snakes, worms and ir fe evolv express proteins that modulate the mammalian coagulation and fibrinolytic systems. Many of these proteins have been isolated and characterized. Understanding the mechanisms by which these exogenous factors from venoms and animal saliva modulate the drugs. This review summ 5 our current knowledge of exogenous prote от venom and saliva that either activate or inhibit the mammalian coagulation and fibrinolytic systems Anonymous (10: @axxaya®) [+l 09/22/22(Thu)07-28:39 Мо.396424770 » >>396425055 Evidence of permanent genetic alteration: https://www.mdpi.com/1467-3045/44/3/73/html >Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line https-//pubmed.ncbi.nlm.nih.gov/36054264/ >Pre-exposure to mRNA-LNP inhibits adaptive immune responses and alters innate immune fitness in an inheritable fashion That last one comes to a conclusion that could have... implications... for the human species as we know it. Or knew it, depending on how bad... Anonymous (ID: 007899) [+] 09/22/22(Thu)07:31:27 No.396425055 » >>396440084 22396424770 >Interestingly, mice pre-exposed to the mRNA-LNP platform can pass down the acquired immune traits to their offspring If this sentence didn't fill you with a sinking sense of foreboding and dread, you didn't fully grasp its implications. Think... ТЕТІ Baked into the genome. Inheritable from parent to child. Do the “elites” who control the world fear losing control? Do the “elites” of the world use parasites to maintain their control? Do the “elites” of the world cover up science in order to protect these parasites which grant them control? Conclusion: Humans are intentionally infected with parasites. Those parasites work their way into the human brain or gut where they begin influencing the behavior of their hosts. Certain parasites are used to kill enemies of the elites. Other parasites are capable of completely taking control over the host. The host is then used to infiltrate human society where the parasite works to change that society in such a fashion as to make it easier for the parasites to spread within that society. [parasite paradise] But are the elites of the world the [real] enemy? Or are they actually controlled hosts, themselves? жз % ФМ Marburg Anthrax What is the Formic Fleet? Truth disguised as fiction? consisted of Hive Queens, male drones, and workers." The entire species shared a hive mind, so the loss of individual workers did not concern them. Who are the Workers? Who are the Drones? Who is the Hive Mind? 6. THE WORKERS Who are the workers? Which group of people acts as one collective whole? What is nepotism? Does this group often claim to belong to the ‘collective’? (((Who))) [really] controls the media? Isra elSrever ABOUT US + PROGRAMS ~ EXPLORE ISRAEL + E [ n h PFA TAS A. Lx 4 4 ) ана ЕН `4 AN ATTACK ON ONE JEWISH COMMUNITY IS AN ATTACK ON ALL JEWISH COMMUNITIES rector Most о RAT | пирин ERACE "lel MORE IP EIRC Tar "BER TRA If Jews represent just 2% of the U.S. population, would it be odd for a media ‘ganization (whose parent company has a Jewish president and Jewish-majority f C-level executives) to also have a Jewish President and Jewish Vice-President, a Jewish-majority of Executive Vice Presidents, and a Lead Political Anchor, Chief Political Correspondent, Chief Political Analyst, Chief Political Director, thief National Correspondent, and Chief Washington Correspondent—all 6 of its “Chief” anchor positions—who are all Jewish, as well as a majority—at least 13—of the network's currently-running shows having Jewish hosts? It's almost as if... 89 Which group of people acts as thick as thieves? thick as thieves idiom Q save Word Definition of thick as thieves COMCAST 4" NBCUNIVERSAL “ NBCUniversal News Grr Й! Ст & СЕО Comcast Se Exec. VP, Comeast : very close and secretive / National Poltical Orector. ср Legal Corresponde. Host of Meet the Press Host of The Beat АЛМ Ma "ot An Meter Present. == Planning President Universal TV — President, Research 1 Meda " 6 с " Preside MBCUniversal President, Programming President, Operations & strane UC n Aion] АЛ. Studio (NBC Televison) ) C Cu (ВСга Vet) Studios (NBC Fant (NBCSpert & NBCSN) Strategen [NEC Sport Meet Atv Қат есі Sock at darn Mier меу / сей Sa VP, News Speciale & Transformation (NBC) Nighy несе Wend а Souto ӘС ipit Се атан Would it be odd for а// 5 divisions of a media GEGEN to have both a Jewish Chairman and a Jewish President? What if its National Political Director, Chief Legal Correspondent, Chief Foreign Affairs Correspondent, and more than half of its executive producers and hosts were also Jewish? If the General Counsel, Sr. Executive VP, and Chairman & CEO of its parent company were Jewish as well? It almost seems like... 90 (((Who))) [really] controls the media? Р, Lead Editor, Editorial Page President & GM, NYT's The net James Ben Wirecutters. Dand Perpich Aden Coen с 09-24 Coronas Rayer Секе wd Ponts kay Y о-уеггер-ге-зепі [over repre zent] %) VERB include a disproportionately large number of (a particular category or type of person), Manging Editor Joseph Kahn ы? Deputy Publisher Deputy Manging Editor Senior VP, NYT Global Arthur Gregg Sulzbeeger Rebecca Blumenstem Paul Walborsky Berlin Bureau Chie! Саон Europe Bureau САТ South Asia Bureau Chief Australia Bureau Chet Amen Sree ick Lye ебу Се есен Damen Caw Chiat White House Correspondent Y Baher ес / ғат If roughly 2% of Americans аге Jews, is it odd that а newspaper’s Chairman & Vice Chairman, Publisher & Deputy Publisher, Managing Editor & Deputy Managing Editor, President & CEO’s spouse, Chief Operating Officer, and majority of its Directors and Exec. Committee are Jewish? What if its D.C., L.A., London, Paris, Rome, Berlin, Central/East Europe, South Asia, and Australia Bureau Chiefs, its Editor-in-Chief of its Editorial Page and Global, Magazine, and Business Editions, and its Chief National, International, Political, Domestic Affairs, Military, and White House Correspondents—all but one *Chief" Correspondent—are also Jewish? nep:o-tism [nepe tizem] %) NOUN the practice among those with power or influence of favoring relatives or friends, especially by giving them jobs: XX Jewish Chair of the NPR Foundation Senice Vice President of News and Editorial Director Howard Wollner Michael Oreskes Fan Cubic, famh Ae Geoffrey Nunberg Yerchok Edeistein "A. X ) Б> g i ~ Сн Cachan ро hentay Andy Borowtz M e iren, a Flatow а Liat About 20% of US taxpayer funded NPR's personnel are of Jewish descent. As merely 2% of the United States population, why are dual American & Israeli Jewish citizens allowed to represent about 1/5 of the US taxpayer subsidized public radio station? It gets worse. 92 Who controls Wall Street? Of the 51 senior executives on Wall Street, 37 are jews or have jewish spouses. (jewish overrepresentation of 3,250% Who controls Big Media? Of the 12 senior executives of the “Big 6” media corporations, 9 are jews or have jewish spouses. (jewish overrepresentation of 3,750%) Who controls Hollywood? Of the 60 senior executives of the major Hollywood studios, 50 are jews or have jewish spouses. (jewish overrepresentation of 4,150%) Who controls Television? Of the 64 senior executives of the major television broadcast networks, 57 are jews or have jewish spouses. (jewish overrepresentation of 4,450%) Who controls Music? Of the 50 senior executives of the major music labels, 39 are jews or have jewish spouses. (jewish overrepresentation of 3,900% Who controls Radio? Of the 46 senior executives of the major radio broadcast net- works, 28 are jews or have jewish spouses. (jewish overrepresentation of 3,050%) Who controls Advertising? Of the 46 senior executives of the major advertising corpora- tions, 31 are jews or have jewish spouses. (jewish overrepresentation of 3,360%) Who controls the News? Of the 67 senior executives of the television and radio news networks, 47 are jews or have jewish spouses. (jewish overrepresentation of 3,500%) Who controls Newspapers? Of the 65 senior executives of the major newspapers and news magazines, 42 are jews or have jewish spouses. (jewish overrepresentation of 3,250%) Who controls E-bay? Of the 9 E-bay executives, 6 are jews or have jewish spouses. (jewish overrepresentation of 3,350%) Who controls Apple? Of the 10 Apple executives, 3 are Jews or have jewish spouses. (jewish overrepresentation of 1,500%) Who controls Yahoo? Of the 13 Yahoo executives, 8 are jews or have jewish spouses. (jewish overrepresentation of 3,100%) Who controls Google? Of the 6 Google executives, 4 are jews or have jewish spouses. (jewish overrepresentation of 3,350%) Who controls Amazon? Of the 11 Amazon executives, 8 are jews or have jewish spouses. (jewish overrepresentation of 3,650%) Who controls Facebook? Of the 3 Facebook executives, 3 are jews or have jewish spouses. (jewish overrepresentation of 5,000% Who controls Microsoft? Of the 17 Microsoft executives, 6 are jews or have jewish spouses. (jewish overrepresentation of 1,750%) Who controls the Economy? Of the 60 senior officials of the US monetary institutions, 39 are jews or have jewish spouses. (jewish overrepresentation of 3,250%) Who controls the Mutual Fund Industry? Of the 40 senior executives of the major Mutual Funds on Wall Street, 26 are jews or have jewish spouses. (jewish overrepresentation of 3,250%) Who controls Professional Sports? Of the 60 senior executives of the major sports leagues, 43 are jews or have jewish spouses. (jewish overrepresentation of 3,600%) Who controls the Southern Poverty Law Center? Of the 22 senior members, 15 are jews or have jewish spouses. (jewish overrepresentation of 3,100%) Who controls the American Civil Liberties Union? Of the 9 executives of ACLU, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,200%) 93 Who controls Goldman Sachs? Of the 9 GS executives, 7 are Jews or have jewish spouses. (jewish overrepresentation of 3,900% Who controls JPMorgan? Of the 10 JPM executives, 9 are jews or have jewish spouses. (jewish overrepresentation of 4,500%) Who controls the Treasury Department? Of the 26 senior Treasury officials, 18 are jews or have jewish spouses. (jewish overrepresentation of 3,450%) Who controls the Federal Reserve System? Of the 7 FR governors, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,850%) Who controls the White House? Of the 11 senior advisors of president Obama, 9 are jews or have jewish spouses. (jewish overrepresentation of 4,100%) Who controls Senate? Of the 20 US Senate Committee Chairmen, 8 are jews or have jewish spouses. (jewish overrepresentation of 2,000%) Who controls Congress? Of the 42 US House Committee chairmen, 6 are jews or have jewish spouses. (jewish overrepresentation of 700%) Who controls the Supreme Court? Of the 9 SC justices, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,200%) Who controls the State Department? Of the 74 senior SD officials, 40 are jews or have jewish spous- es. (jewish overrepresentation of 2,700%) Who controls the Justice Department? Of the 47 JD officials, 22 are jews or have jewish spouses. (jewish overrepresentation of 2,360%) Who controls the Anti-Defamation League? Of the 53 executives of the ADL, 53 are jews or have jewish spouses. (jewish overrepresentation of 5,000%) Who controls the Defense Department? Of the 110 DD officals, 40 are Jews or have jewish spouses. (jewish overrepresentation of 1,800%) Who controls the Group of Thirty? Of the 43 GoT members, 23 are jews or have jewish spouses. (jewish overrepresentation of 21,200%) Who controls the Bilderberg Group? Of the 35 committee members, 16 are jews or have jewish spouses. (jewish overrepresentation of 4,600%) Who controls the Trilateral Commission? Of the 56 committee members, 23 are jews or have jewish spouses. (jewish overrepresentation of 16,400%) Who controls the Council on Foreign Relations? Of the 43 CoF directors, 28 are jews or have jewish spouses. (jewish overrepresentation of 3,250%) Who controls the Ivy League? Of the 24 senior administrators, 20 are jews or have jewish spouses. (jewish overrepresentation of 4,150%) Who controls the Think Tanks? Of the 30 senior executives, 18 are jews or have jewish spouses. (jewish overrepresentation of 3,000%) “We have corrupted the blood of all the races of Europe — perhaps we have infected them. Today, everything is Jewdified. Our thinking is in everything living, our spirit rules the world. We are the masters, for everything that has power today is the child of our spirit. One may hate us, one may drive us away. Our enemies may triumph over our physical weakness. But we are no longer to be gotten rid of. We have devoured the peoples, conquered the races, defiled them, broken their strength, made eve- rything rotten, lazy, and corrupt with our stale culture. Our spirit can no longer be exterminated.” -Dr. Kurt Münzer [Jew] in his novel 'Der Weg nach Zion' (The Way to Zion) It gets worse. 94 List of most popular websites From Wikipedia, the free encyclopedia Alexa top 100 global SimilarWeb top 100 Domain websites websites Type (As of April 3, 2017)/2! (As of May 2017)! Principal country google.com Internet services and products ЕЕ 05. youtube.com Video sharing ШЕШ 05. facebook.com Social network =z US. Mark Zuckerberg Facebook, Inc. Sheryl Sandberg facebook Key people Mark Zuckerberg (Chairman and CEO) Sheryl Sandberg (СОО) Sandberg was born іп 1969 іп Zuckerberg was raised|Jewishjand had his Ваг Р 9 Sundar Pichai Washington, D.C. to a[Jewist]famity Mitzvah when he turned 13.1211 Alphabet Inc. oe || 7mm. August 2014 "Do the right thing" Type Subsidiary Formerly Google Inc. (1998-2015) ES (used from 2004-2015) Internet Larry Page Computer software Computer hardware September 4, 1998; 18 years ago Menlo Park, Californial!1t2] Founders Larry Page Sergey Brin "- Headquarters Googleplex, Mountain 8 HAA R E I Z View, California, U.S.) à Tund MM Lawrence Edward Page was born on March 26, 1973, in East Key people Sundar Pichai (CEO) Lansing, Michigan. His father, Carl Vincent Page, Sr., was a Larry Page (CEO - Alphabet Inc.) Sergey Brin (President = his mother, Gloria W. Page, also taught computer programming. Alphabet Inc.) Page speaking at the European Parliament on June 17, 2009 Gloria i Jewish] Carl, who died, in 1996, was not. Susan Wojcicki YouTube, LLC Pichai was born in Madurai, Tamil Nadu, India professor of computer science at Michigan State University, where Sergey Brin Early life and education езі] Brin was born in Moscow in the Soviet Union, to Russian Pewish] parents 0 | | e Spouse(s) Anne Wojcicki (m. 2007; div. 2015)/41°1 YouTube now operates as one of Google's subsidiaries. Anne Wojcicki e She is the current CEO of YouTube. Sergey Brin in 2008 She is the daughter of Esther Wojcicki, an educator of Russian|Jewish|des Anne E. Wojcicki (/моо d3rtski/ woh-JIT-skee; Polish: Wójcicka pronounced [vuj Yitska}; born July 28, 1973) is an American entrepreneur and the co-founder and chief executive officer of the personal genomics company 23andMe. She was formerly married to Google co- Her mother is Her sisters are Susan Wojcicki, CEO of YouTube and a former executive at Google Wojcicki at TechCrunch Disrupt SF 201 What are the chances that 2% of the US population would produce those who control the three biggest websites? Its almost like they're working together. 90% of american media is owned by 6 corporations: a demonstrable fact everyone can research and see. The CEOs and executives of those 6 corporations are jewish: also demontrable by looking at those corps employee charts. But Jews insist in calling it a "conspiracy theory", even though no "conspiracy" is involved, and none of this is theoretical. Peter Chernin ХХ Gerald ТеуіпХХ Michael LyntonXX Brian RobertsKX Sumner RedstoneXx Michael Eisner XX News Corp Фу 7 TimeWarner SONY COMCAST масом J EF ао ge. [] NATIONAL GEOGRAPHIC CHANNEL hulu » е... өше T ТІМЕ өй іа Entertainment Southern Living hulu THE INTERNATIONAL JEW: Controlling the world's sources of news, All ! THE WORLD'S Judaan [Jews] can always prepare the minds of FOREMOST PROBLEM the people for its next move. The greatest ге exposure yet to be made is the way that news is manufactured and the way in which the mind of whole nations is molded for a purpose. When the powerful Jew is at last traced and his hand j revealed, then comes the ready cry of persecution and it echoes through the world press. The real / N causes of the persecution (which is the oppression - d THE COMPLETE of the people by the financial practices of 5.2 4 VOLUMES the Jews) are never given publicity HENRY FORD. 1920 96 Who are the workers? Do members of the jewish race have a naturally weakened immune system? Would this make them ideal hosts for parasite-infested mind control? WATCH KABBALAT SHABBAT LIVE! // Stream services here at 7:25 pm Central/8:25 pm Eastern. —> included in an expanded 38-disease panel. Another 16 diseases for genetic testing recommended by the Jewish Genetic Diseases Consortium. An additional 19 are are common among particular groups of Sephardic * | and/or Mizrahi * Jews. Information on the latter two groups of Di : diseases are available on the JGDC website. purs Asked Que HEALTH & WI Bloom Syndrome Advertisement Bloom syndrome is a disorder that can result in short stature, skin rashes, sensitivity to sunlight, high-pitched voice, distinctive facial features, infertility and a heightened risk of My Jewish Learning is a not several other diseases, including cancer, pulmonary disease and relies on your hq immune system abnormalities. Life span is often significantly DONATE shortened due to susceptibility to cancer and other complications. Carrier frequency is one in 134 Ashkenazi « Jews. Further Resources: National Institutes of Health Bloom's Syndrome Foundation Bloom's Syndrome Association BloomSyndrome Foundation (Netherlands) Bloom's Syndrome Registry Blooms Connect Canavan Disease Canavan Disease is caused by the deterioration of white matter in the brain, which in turn impedes the function of nerve cells throughout the body. Symptoms typically occur within the first nine months of life and include a failure to develop basic motor skills, enlarged head and poor muscle tone. Over time, seizures, difficulty in swallowing, paralysis and retardation can result. Affected individuals typically live through childhood only, though some have survived into adolescence and beyond. A milder and less common form of the disease features far less dramatic symptoms that are sometimes never recognized and do not appear to shorten lifespan. About 1 in 55 Ashkenazi Jews are carriers of the disease. Further Resources: National Institutes of Health Canavan Foundation Canavan Research Foundation Cystic Fibrosis Cystic Fibrosis is a condition in which the body produces a thick mucus that can clog the lungs and impair organ function. Symptoms can include wheezing, chronic coughing and inflammation leading to breathing problems and bacterial infections in the lungs. Over time the condition can cause digestive problems and reduced pancreatic function. Improved treatments have led to increased lifespan in recent decades, with many sufferers in the United States now surviving into their 30s and 40s. Carrier frequency is about 1 in 24 Ashkenazi Jews and about 1 in 26 Sephardic/Mizrahi Jews. Further Resources: National Institutes of Health Cystic Fibrosis Foundation Boomer Esiason Foundation Cystic Fibrosis (online community) CF Living Cystic Fibrosis Worldwide Cystic Fibrosis-Reaching Out Foundation Cystic Fibrosis News Today Familial Dysautonomia Familial Dysautonomia is a disorder that affects the autonomic nervous system, which controls involuntary actions, and the sensory nervous system, which controls activities related to the senses. The disorder features a wide range of symptoms that typically begin in infancy and increase in number with age. These include poor muscle tone, feeding difficulties, poor growth, lack of tears, frequent lung infections and difficulty maintaining body temperature. In older children, the disease can result in bed wetting, vomiting, reduced sensitivity to temperature and pain, poor balance, scoliosis, kidney and heart problems, and learning difficulties. Affected adults can suffer from lung and kidney problems and impaired vision. The disease results in shortened lifespan, with affected individuals born in 2006 projected to have a 50 percent chance of survival to age 40. About 1 in 31 Ashkenazi Jews are carriers of the disease. Further Resources: National Institutes of Health Dysautonomia Foundation National Dysautonomia Research Foundation Familial Dysautonomia Now Foundation Familial Dysautonomia Hope Foundation Dysautonomia Youth Network of America Familial Hyperinsulinism Familial Hyperinsulinism is a condition that causes irregular levels of insulin, the hormone that controls blood sugar levels. Symptoms can occur very soon after birth, and can include lethargy, hypoglycemia, seizures and difficulty feeding. Repeated episodes of low blood sugar can lead to more serious complications. Treatment with drugs or glucose injections can help manage the disease. Surgery to remove all or part of the pancreas is also common. The carrier frequency for Familial Hyperinsulinism is about 1 in 68 Ashkenazi Jews. Further Resources: National Institutes of Health Congenital Hyperinsulism International Fanconi Anemia C Fanconi Anemia C is one of several subtypes of a disorder that impairs the ability of bone marrow to produce new blood cells. Signs of the disease are often apparent at birth. Affected individuals often suffer from bone marrow failure, infertility, short stature, increased incidence of certain types of cancer, gastrointestinal difficulties and various physical abnormalities. Drugs and bone marrow transplantation are used to manage the disease, but most of those affected die in early adulthood. The carrier frequency among Ashkenazi Jews is 1 in 100. Further Resources: National Institutes of Health Fanconi Anemia Research Fund Gaucher Disease Gaucher disease is the most common genetic disease affecting Ashkenazi Jews. The disease results from a specific enzyme deficiency that can impact many of the body's organs and tissues. There are various types of the disease. The most common is Type 1, whose symptoms include enlargement of the liver and spleen, anemia, low red blood cell count, lung disease and bone abnormalities. Other forms of the disease affect the cardiovascular and central nervous systems. Symptoms can vary widely in intensity. Some of those affected with the more severe forms may suffer extremely shortened lifespans, while others can manage the disease successfully over the long term. The carrier frequency for Ashkenazi Jews is about 1 in 15. Further Resources: National Institutes of Health National Gaucher Foundation Children's Gaucher Research Fund Joubert Syndrome 2 Joubert Syndrome 2, also known as Cerebelloculorenal Syndrome, is a subtype of a condition whose symptoms include poor muscle tone, abnormal eye movements, intellectual disability and poor motor coordination. Though symptoms can vary, the condition is marked by the underdevelopment of the cerebellar vermis area of the brain, which controls balance and coordination. The condition can also be associated with kidney or liver failure. Symptoms typically begin in infancy. Treatment options are solely supportive and symptomatic. The carrier frequency among Ashkenazi Jews is 1 in 100. Further Resources: National Institutes of Health Joubert Syndrome & Related Disorders Foundation Lipoamide Dehydrogenase Deficiency (E3) Lipoamide Dehydrogenase Deficiency (E3) is a condition caused by an enzyme deficiency that leads to the buildup of lactic acid in the body. The symptoms typically present in childhood and are quite varied, including serious fatigue, episodes of hyperventilation, vomiting and abdominal pain. The disorder can be fatal in childhood, though it can also often be managed through diet and immediate medical attention when lactic acid buildup occurs. The carrier frequency among Ashkenazi Jews is 1 in 107. Further Resources: National Institutes of Health Genetic Disease Foundation Maple Syrup Urine Disease (1B) Maple Syrup Urine Disease is a disease characterized by deficiency in enzymes needed to break down certain amino acids. The disorder derives its name from the distinctive sweet odor of the urine of those affected. Symptoms typically begin shortly after birth and indude irritability, poor feeding and lethargy. The disease can usually be successfully managed through a strict dietary regimen, but left untreated can lead to neurological damage, seizures, coma and death. The carrier frequency among Ashkenazi Jews is 1 in 97. Further Resources: National Institutes of Health National Organization for Rare Disorders MSUD Family Support Group Mucolipidosis IV Mucolipidosis IV is a disorder characterized by severe underdevelopment of intellectual and motor skills. Symptoms are usually apparent within months of birth. Many of those affected have limited or absent speech, impaired vision, difficulty walking independently, digestive problems and poor muscle development. Though many of those affected by the disease survive into adulthood, they may still have shortened lifespan. The carrier frequency among Ashkenazi Jews is 1 in 89. Further Resources: National Institutes of Health National Organization for Rare Disorders Mucolipidosis IV (ML4) Foundation Nemaline Myopathy Nemaline Myopathy is a disease characterized by muscle weakness, typically in the face, neck and other muscles close to the center of the body. Symptoms are generally present in childhood and can vary widely in intensity. In severe cases, weakness in the respiratory muscles can be life-threatening, but in most cases affected individuals can lead active lives. Carrier frequency in Ashkenazi Jews is 1 in 168. Further Resources: National Institutes of Health National Organization for Rare Disorders A Foundation Building Strength Nemaline Myopathy Support Group Walker Warburg Walker Warburg is a disease characterized by severe abnormalities in the muscles, brain and eye. Symptoms are typically evident very early in life and include severe retardation, small head, poor muscle tone, small eyes, blindness, seizures and feeding difficulties. Most affected individuals do not survive past the age of three. Carrier frequency is 1 in 120 for Ashkenazi Jews. 98 Niemann-Pick Disease Niemann- Pick refers to a collection of metabolic disorders characterized by an enzyme deficiency that leads to the buildup of certain types of lipids in the body. Individuals affected with the most severe and most common form, Type A, typically develop an enlarged liver and spleen within the first three months of life, followed by a progression of other symptoms that normally lead to death within the first four years. Other subtypes generally develop later and are not as severe. Carrier frequency among Ashkenazi Jews is lin 115. Further Resources: National Institutes of Health National Niemann-Pick Disease Foundation Spinal Muscular Atrophy Spinal Muscular Atrophy is a disorder caused by the loss of motor neurons in the spinal cord and brainstem. The disease has multiple types distinguished by the age of onset and the severity of symptoms. In the most severe forms, symptoms begin very early and often lead to death within several months to two years as a result of respiratory problems. With milder forms, symptoms begin later in childhood or even into adulthood and, depending on their severity, can sometimes permit a normal lifespan. All forms of the disease involve some degree of muscular weakness that can lead to atrophy as well as difficulty walking, breathing and eating. Carrier frequency is 1 in 41 for Ashkenazi Jews and 1 in 10 for Egyptian Jews. Further Resources: National Institutes of Health Cure SMA FightSMA Spinal Muscular Atrophy Foundation Spinal Muscular Atrophy Tay-Sachs Disease Tay-Sachs Disease is a disorder characterized by an enzyme deficiency that destroys neurons in the brain and spinal cord. The most common form of the disease begins within months of birth and entails the progressive loss of motor skills, neurodegeneration, seizures, blindness, spasticity and eventually total incapacitation and death. A far more rare form of the disease begins later in life, from childhood to adolescence and beyond, and the symptoms are milder, though they include poor coordination, tremors and slurred speech. As the disease progresses, it can lead to mental and behavioral abnormalities, induding bipolar disorder and psychoses. Carrier frequency for infant onset Tay-Sachs among Ashkenazi Jews is 1 in 27. Further Resources: National Institutes of Health National Tay-Sachs and Allied Diseases Association Cure Tay-Sachs Foundation Torsion Dystonia Torsion Dystonia, also known as dystonia musculorum deformans, is characterized by muscle spasms, contractions, and tremors. Symptoms usually begin in early childhood and are progressive. Sometimes symptoms are isolated in one part of the body, and sometimes affect many. The disease is caused by a mutation in the TOR1A gene, but not all people with the mutation develop the disease (only 30-40%). Somewhere between 1 in 3000 and 1 in 9000 Ashkenazi Jews are affected by this disorder. Further Resources: National Institutes of Health Usher Syndrome Usher Syndrome is a disorder that affects nerve cells in the ear and photoreceptor cells in the retina. The disease is marked by total or partial loss of vision or hearing that worsens with time. There are several types of the disease. In Type 1, affected individuals are typically born with hearing loss and difficulty balancing due to abnormalities in the inner ear. In Type 3, vision and hearing loss typically begin later in life. Carrier frequency for Type 1F is 1 in 147 for Ashkenazi Jews and 1 in 120 Ashkenazi Jews for Type 3. Further Resources: National Institutes of Health Usher Syndrome Coalition Hear See Hope Who are the workers? Why do jews often claim to be part of the ‘collective’? Do parasites cause schizophrenia? Are jews prone to schizophrenia? @ pubmed.ncbi.nim.nih.gov/7973467/ Abstract To limit the genetic heterogeneity of schizophrenia, this study focused on the widely extended pedigrees of Ashkenazi Jewish schizophrenia probands. The hypothesis posed is that the increased prevalence among the Ashkenazim of the rare lysosomal enzyme disorders, Tay Sachs disease (TDS), caused by low levels of hexosaminidase A, and Gaucher's disease (GD), caused by low levels of glucocerebrosidase, might contribute to the demonstrated increased vulnerability to schizophrenia in this ethnic group. Signs and symptoms characterizing the candidate illnesses were systematically queried by the family history method. Rates and relative risks for symptoms characterizing these disorders and for several nonautosomal illnesses associated with TSD and/or GD (i.e., amyotrophic lateral sclerosis and Hodgkin's disease, leukemia and lymphoma) are significantly elevated in the schizophrenia pedigrees, compared to controls. The conditions with elevated rates and risks have been associated with chromosomal regions 1q21 and 15q23-q24. These areas are suggested as candidate regions for future targeted deoxyribonucleic acid (DNA) research in schizophrenia. Jewish insanity Among the Jews, the proportion of insane has been observed to be very large.’ From statistics collected by the German researcher Buschan in the late 19th century, he concludes that they are four to six times more liable to mental disease than are non-Jews. Lombroso quotes Servi ("Gli Israeliti di Europa," 1872) to the effect that in Italy there is one insane among 391 Jews, nearly four times as many as among the Catholic population of that country. Verga ("Archivio di Statistico," 1880) shows that in 1870 there was one insane among 1,775 Catholics in Italy, while with the Jews it reached the alarming proportion of one insane in i + “AN ге! n Nos. 9 Е 384 of population. A similar phenomenon has been 52 . observed in other countries. In the various provinces of E ЕН Germany and also іп Denmark the percentage of Jewish a insane is very large, as is seen from the figures in the appended table on the left. Maximoff and Sikorsky (Proceedings of the Twelfth International Medical Congress," vol. iv., part 1., p. 661.) have shown that similar conditions prevail in Russia. Among the troops in Kiev, respectively 0.91% and 0.99% of Russians and Poles were determined to be insane. For Jews, this number was more than twice as high: 2.19%. C. F. Beadles, who has investigated the subject in the Colney Hatch Asylum in London, shows that there appears to be a great preponderance of general paralysis among Jewish males, over 21 per cent of all the male Jews admitted being subjects of that disease, while the proportion of cases of general paralysis among all the males admitted to the hospitals for the insane in England and Wales is only 13 per cent. "It is evident," says Mr. Beadles "that among the Jewish males, admissions for general paralysis are 60 per cent more frequent than among the non-Jewish English and Welsh." The frequency of general paralysis in Jews observed by Beadles is confirmed by Hirschl, who found among 200 of his paretic patients 40 Jews, 1.е., 20 per cent (Hirschl, "Zur Aetiologie der Progr. Paralysis," in "Jahrbuch für Psychiatrie," xiv. 449). Pilez also found a large proportion of pareties among the Jews in Vienna: 18.75 per cent of all cases. He adds that the Jews' acute struggle for existence, and their peculiar occupations as merchants, speculators, stockbrokers, etc., are etiological factors. [1] http://www, jewishencyclopedia.com/articles/8 1 23-insanity 99 Who are the workers? Why do jews often claim to be part of the ‘collective’? Do jews use patriarchal lineage or matriarchal lineage to determine ‘Jewishness’? Define ‘congenital transmission’? [...from mother to child] What is the [real] reason jews use matriarchal lineage to determine ‘Jewishness’? | Chagas Disease сап also Бе transmitted: * Congenitally from mother to child |“ Through blood transfusion * Through organ transplantation If the parasite fails to transfer in utero, is there an alternative method Jews use to transfer their parasites? Do parasites prefer young hosts? Are mind-controlling parasites sexually transmitted? Can they be transmitted through spit and saliva? Would an open wound facilitate this transfer? What is 'Direct Oral Suction’? Circumcision >>> Parasite Parasite >>> Mental Illness Mental Illness >>> Hive Mind Hive Mind >>> Collective Why do jews [really] claim to be part of the ‘collective’? 100 @ rules.cityofnewyork.us/tags/direct-oral-suction Search | Email Updates | Contact Us /isitors Government Office of the Mayor SET TEXT SIZE: [=] [+] E) Ti TRANSLATE THIS PAGE = PRINTER FRIENDLY LOGIN | REGISTER direct oral suction Adopted Rules: Closed to Comments Adopted Rules Content: Statement of Basis and Purpose Statutory Authority These amendments to the Health Code are promulgated pursuant to sections 558 and 1043 of the Charter. Sections 558(b) and (c) of the Charter empower the Board to amend the Health Code and to include in the Health Code all matters to which the authority of the New York City Department of Health and Mental Hygiene (the "Department") extends. Section 1043 of the Charter grants the Department rule-making authority. The amendment is also made pursuant to the Department's historic power to supervise the control of communicable disease in New York City. Background The Charter provides the Department with broad jurisdiction to protect and promote the health of all New Yorkers. The control of communicable disease is a core public health function. At its meeting on September 13, 2012, the Board of Health voted to amend Article 181 by adding a requirement that, prior to a circumcision involving direct oral suction (“005”) of infants less than 60 days of age, the person performing the circumcision obtain the written consent of a parent. In the consent, the parent acknowledges that he or she is aware that the Department recommends DOS, also known as metzitzah b'peh, not be performed because of the risk of brain damage and death. Circumcisions that include DOS involve direct contact between the mouth of the practitioner designated by the religious community to perform a circumcision, known as a mohel, and the infant's circumcision wound. The opposition of some members of the Orthodox Jewish community who practice DOS has made enforcement of the consent requirement difficult. Since the provision went into effect, there have been six cases of herpes simplex-1 (HSV-1) infection reported in infants following DOS in New York City, including four cases reported in 2014. In two of these six cases, the mohel who was associated with the case was identified in the course of the Department's case investigation, and a signed consent form was provided by the mohel in one of these two cases. The limited effectiveness of the consent requirement at this time prompted the department to consider alternative approaches to address this problem. In February, 2015, the Mayor announced a new strategy to address this problem. As part of this approach, the Department will work cooperatively with leaders of the Orthodox Jewish community to educate parents about the risks of DOS. These educational efforts will include working with hospitals throughout the City to distribute educational materials about the risks of DOS to the parents of all newborn infant boys, as well as making this information available at other health care settings, such as obstetric and pediatric practices. These materials, which include a Department telephone number for parents who may have questions, have been translated into Yiddish and are being distributed at hospitals and medical offices that service communities where DOS is practiced. The Department's educational initiative is more likely to succeed if the Department can restore a strong relationship with these communities. Accordingly, the Board is repealing section 181.21 of the Health Code. 101 Do the infected live in filth and squalor? Are jews sometimes referred to as ‘goblins’? Why is ‘goblin mode’ spreading? J that men and women were w of one another, They have toilets, But these god. up. The filth,” Craig rooms 1 saw six Life and style Slobbing out and giving up: why are so many people going ‘goblin mode’? THE WORMS CRAWL IN, THE WORMS CRAWL OUT — Old stone toilet reveals Jerusalem’s wealthy elite had intestinal parasites Scientists identified egg remnants from roundworm, tapeworm, whipworm, and pinworm. 1/14/2022, 11:44 AM Does early infection result in morphological changes to the host's body? Could this be used to identify the infected? [а] @ pubmed.ncbi.nlm.nih.gov/23225875/ What is ‘Aggressive Mimicry’? > J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635. Influence of latent Toxoplasma infection on human personality, physiology and morphology Sees cons of the Toxoplasma-human model in studying the manipulation hypothesis Wasmannian Mimicry In Wasmannian mimicry, the mimic resembles a model that it lives along with in a nest or colony. The mimic, a predator, appears as a friend and member of the same species, taking on its appearance and mannerisms. Aggressive mimicry From Wikipedia, the free encyclopedia Aggressive mimicry is a form of mimicry in which predators, parasites, or parasitoids share similar signals, using a harmless model, allowing them to avoid being correctly identified by their prey or host. Zoologists have repeatedly compared this strategy to a wolf in sheep's clothing. 2131 aggressive mimicry could include various types of exploitation, 14 In its broadest sense, SW EU European woman (top) ы Jewess (bottom) Ant in Mozambique (top) Mimic, a jumping spider (bottom) Ш Anonymous (ID 102 Can dogs detect parasites? Do dogs become aggressive against the infected? Do jews like dogs? Who Doesn’t Love a Cute Puppy? г. . Jews, traditionally. | All dogs are bad and their owners accursed, Israeli city's rabbis rule Religious edict in haredi town of Elad says canines are forbidden because they bark at people and may scare them: 'And because of its bark it is a bad dog even if does not bite’ By CNAAN LIPHSHIZ 12 July 2019, 4:50 pm | LHE JERUSALEM POST CORONAVIRUS ISRAEL NEWS WORLD NEWS MIDDLEEAST BUSI Dog tax proposed by haredi An annual fee, proposed by United Torah Judaism MKs Moshe Gafni | 6 k ere Dogs can smell when one is infected with parasites: 4.3.4 The Dog of Alba Another literary tradition, which, however, is not connected to the culinary topoi discussed so far, but which is gladly taken up in connection with the topic of the foetor judaicus, is the story about the dog of Alba. The story must have been told before the expulsion of the Sephardim from the Spanish kingdom in 1492, since it involves the Jewish community of Alba. According to Joseph Eugene Gillet (1888-1958), Professor of Romance Languages, who analyzed and published the various texts in an essay, the oldest version known today, which was written in verses, comes from Johannes de Trasmiera, whose texts probably appeared in print іп 1524 or a short time later." The story tells of the dog of Anton Gentil, who attacks only Jews іп the city of Alba. Alba probably means the small town of Alba de Tormes, in which the ancestral seat of the Dukes of Alba is located, because the duke is also referred to in onc place.** Should the Duke of Alba actually be meant, the period of the story can be narrowed down even more, because the Alvarez de Toledo family were Counts of Alba until 1472 when Castilian King Henry IV conferred the title of duke on them. Consequently, there remains a window of twenty years, from 1472 to 1492. Thus the probability increases that the story could not have been written too long before 1524, if the first version that we have received from Johannes de Trasmiera was not even the first one. The story goes AC зогу BOCS on to explain that Jews take the biting dog to court. The judge sentences the dog to death and lets him be handed over to the Jews so that they can punish him and take revenge. However, the dog is would-be executors again. to move to coming into the city, even if he is disguised as a Christian: “If any Jew showed up disguised as a Christian, and touched him [the dog] with their hand, which he [the dog] immediately kissed, he tore the Jew's hand apart, since such a disguise did not trick him, if a Christian dressed like a Jew, he then remained seated.”*5 Stigmatizing New Christians in Early Modern Spain- Julia Gebke (10: -DFt4lpüR ) == 10/28/21(Thu)23:49:22 0.345241781 » 22345224619 # I'm trans but i like to pretend I'm not when Dogs Can Sense I'm on the internet. | dont really have a lot Bad People of friends in real life. | think they don't according bs science really like my humor. | never really feel like | have a community more than when I'm teasing other transgenders on 4chan d because I've never seen a group of people having more fun. | don't blame Dogs Can Sense Bad iris them for hating us because i hate myself too. i | have a friend from childhood who told People according to me to get a pet and i really like doggos but | noticed that every dog seems to science. hate me so i don't want to get one. | think its because i STANK 104 An interesting story: >you probably won't believe this but.. If you think that is unbelievable. Let me tell you my story. When I was young, | distinctly remember the day my life changed. | was an outgoing, charismatic child who quickly made friends with everyone. My parents even had to impose limits on the number of kids | could invite to my birthday parties (to the disappointment of many). Then, when | was 11, | specifically remember not only the day, but even the very moment 1 lost control over my behavior. A spirit of fear came upon me so suddenly and with such force that I lost the ability to speak to strangers, nor could | even stand in front of crowds without visibly shaking in abject terror. | also noticed around this time, dogs began to attack me on sight. Not just one dog, or two dogs, but a great many dogs. Even the friendliest of them would not hesitate to sink their teeth deep into any part of me that | carelessly left exposed. Their owners were always flabbergasted and apologized to no end, but | learned to expect it, and | had to keep my distance from certain breeds. What makes my story even more strange was that | also distinctly remember not only the day, but even the very moment | regained control over my body. It was exactly 20 years later. | was required to give a speech, and | suffered so much mental anguish from it that | felt like something inside of me suddenly broke. That moment, whatever had been controlling my body had vanished. Within a week, the crippling fear which had previously enveloped my mind was now no more. What is even more strange is that giving public speeches suddenly became my new favorite thing in the whole world. It was as if my life had returned to the state in which it was in back when | was eleven. Even dogs forgot their hatred of me. It is strange to think of it now because | can remember the feeling of losing control, and | can remember the feeling of regaining it. Is it weird that | wonder if maybe | had something inside of me; something that those dogs could detect but | could not? | probably would have forgotten all of this but for a very similar thing happening to my four year old niece. You see, a family member of mine has the friendliest dog in the world. But for reasons that we did not understand, one day, the dog tries to kill my niece. She was not hurt, but we have had to keep the dog and my niece separated ever since. No one understood why. We still don't understand why, but something strange happened to my niece not long after this. You see, almost a year later, my niece is suddenly diagnosed with a massive brain tumor. No one believes my theory, but | can't help wondering if, just like me, something had gotten inside my niece, and the dog could sense it. And whatever that thing was inside of her, it somehow caused that tumor. | know this sounds unbelievable, but do you think dogs can sense ghosts, or whatever that thing was inside of her and me? Ш medicalnewstoday.com/articles/323620#summary = NEWSLETTER MepicaLNewsTopay Can dogs sense tumors? Researchers are currently exploring the possibility of using specially trained medical detection dogs in the diagnosis and tracking of cancer. Canine cancer detection is a simple, noninvasive procedure with potentially fewer side effects : for people. However, further investigation is necessary to validate this method for use in clinical Or do dogs sense parasites practice. which cause the tumors? Hollywood coincidence or truth disguised as fiction? LINK Why do jews [really] hate dogs? 105 SCIENCE пот HEED -a ft News Space& Physics Health РізпегЕапһ — StrangeNews Animals History | Forums 7 Strange Facts about the 'Mind-Control' Parasite Toxoplasma Gondii By Stephanie Buck October 18, 2016 К " Source: https:/www livescience.com'56529-strange-facts-about-toxoplasme-gondil-parasite html Can a parasite control your mind? A single-cell parasite, Toxoplasma допаї is perhaps best-known for its connection to cats. The parasite can move from its feline host to humans, most commonly through contact with cat feces. And while the parasite typically only causes mild Infection (people may have flulike symptoms), in people with weakened Immune systems, infections can cause serious problems, from seizures to severe lung problems. But a Т. gondil infection can also have some downright bizarre effects. Over the years, the parasite has not only surprised and stumped researchers, but has also led to new insights into how human behaviors work. T. gondii has been shown to increase fearlessness in rats. Rats infected with the parasite seem to lose their typical fear of cats, and more specifically, their fear of cat urine. A 2011 study in PLOS ONE suggested that infected rats start to feel a type off'sexual attraction ]to the smell of cat urine, rather than their usual defensive response to the scent. This might be because a Т. gondii infection changes neural activity in certain areas of the brain, the researchers said. The parasite “averwhelms the innate fear response" so that rats no longer avoid the scent of cat urine, they wrote. Instead, the amorous rats are drawn to it — and to their deaths. T. gondii can leap between almost all warm-blooded animals. Cats and rats aren't the only animals that can host the parasite. T. gondijis an exceptional parasite in that it can leap from almost any warm-blooded creature to another. Although an estimated 6 in cf 10 infectious human diseases are zoonotic (meaning they can hop from animals to humans), hardly any share 7. gondi/s wide versatility of host organisms, according to the Centers for Disease Control and Prevention. Scientists havent pinpointed exactly why this is, but some research, such as a 2011 study published in the Proceedings of the National Academy of Sciences, suggests that at least part of the answer may be found in the parasite's proteins: When a certain type of protein is removed, the parasite is no longer virulent, Researchers speculate that this is because those proteins disrupt key proteins in the host's cell that are key to the host's immune response. Others suggest that T. gondii could contribute to other types of mental illness, even suicide. Schizophrenia isn't the only psychological disorder that is possibly linked to T. gondii. А 2011 study that was done in mice and published in the journal PLOS ONE owed that the parasitemay cause infected brain cells to release high levels of the neurotransmitter dopamine. Increases in doparninefould play a hand in certain mood disorders, such as bipolar diseaseJwhiclt has been linked to dopamine irregularities, according to the study. Other research done in humans suggests that Toxoplasma could be connected to impulsivity, and even suicide. The parasite wouldn't be the first pathogen to alter people's brain and behavior: The rabies virus, which is deadly in people, has long been shown to have devastating neurological effects. Some studies suggest that|T. gondii is linked to schizophrenia. One of Toxoplasm4's most frightening — and most controversial— possible effects is its impact on the mind. If a woman is infected with the parasite while she is pregnant, her fetus may be at risk for developing schizophrenia and other mental disorders, according to a 2006 study of people living in ark, published in the. journal Biological Psychiatry. And that's notall. A 2014 study that was published in The Journal of Nervous and Mental Disease f in patients with schizophrenia, providing further evidence for a potential link between the parasite and the mental illness. T. gondii has no cure. There are no medications available to treat T. gondii, Other than remaining vigilant to try to prevent infection, there's not too much else to do. Іп a 2005 study in the American Journal of Obstetrics and Gynecology, health care providers advised pregnant women and women looking to become pregnant to get screened for T. gondii. Тһе authors also suggested that women understand the risk factors for infection, such as exposure to cats (and particularly litter boxes and feces), consuming improperly cooked meat and drinking untreated water. Up to half of the world may be infected. Researchers can't seem to agree on just how widespread T gondiiis, in part because many cases may go unreported. A 2002 study in the journal Clinical Microbiology id Infection estimated that between 16 to 40 percent of people worldwide are infected, but in certain regions, such as parts of Central America, South America and continental Europe, the rates are between 50 to 80 percent. A 2011 study in the Journal of Glabal Infectious Diseasesgave a much higher estimate of the numbers of people infected: about 6 billion people worldwide, or more than 80 percent of the world. The Centers for Disease Control and Prevention estimates that about 60 million people in the United states — or nearly 20 percent — are infected. A simple blood te: can determine whether you have T. gondii antibodies, which indicate infection with the parasite. [7 Absolutely Horrible Head Infections] Most of the time, T. gondii has no symptoms. Though T. gondii can cause flulike symptoms in mild cases, a 2014 study in the American Journal of Tropical Medicine and Hygienesuggested that in the vast majority of cases, people experience only mild symptoms, or по symptoms at all. Indeed, this may be why the parasite has been largely neglected by researchers, the authors Wrote. The parasite is most dangerous to those with preexisting conditions, such as diseases that contribute to a suppressed immune system. But most people infected with T. gondii wil never even know they have it Rabbi Fears Genetic Studies Will Show That Jews Carry Genes That Are Polluting The World' FEBRUARY 20, 2020 By СЕТТЕАМ — 11 COMMENTS Because of the statistically high incidence of[schizophrenia] land Pipolar disorder] disorder|in the Jewish Ashkenazi community, there have been several ongoing medical studies requesting volunteers to help scientists better understand the biological basis of these condition: Homosexuality and Judaism From Wikipedia, the free encyclopedia "LGBT topics and Judaism" redirects here. For transgender topics in Judaism, see Transgender people and religion § Judaism. The subject of homosexuality and Judaism dates back to the Torah. The book of Vayikra (Leviticus) is traditionally regarded as Classifying sexual intercourse between males as а foelvan (something abnorred or detested) that can be subject to captal punishment by the currently non-existent Sanhedrin under halakha (Jewish law) The issue has been a subject of contention within modem Jewish denominations, and has led to debate and division. Traditionally. Judaism has understood homosexual male intercourse as contrary to Judaism, and this opinion is still maintained by Orthodox Judaism. On the other hanc, Reconstructionist Judaism and Reform Judaism do not hold this view, and allow both homosexual intercourse and same-sex marriage. Conservative Judaism's Committee on Jewish Law and Standards, which until December 2006 held the зате position as Orthodoxy, has since issued multiple opinions under its phiosophy of pluralism; one opinion continues to follow the Orthodox position while another opinion substantially liberalizes the view of homosexual sex and relationships (while continuing to regard certain sexual acts as prohibited). gayest city on earth QAI images News |) Videos Q Shopping + More About 760,000 results (0.71 seconds) Tel Aviv Tel Aviv Pride Parade is widely recognized as one of the leading parades in the world, with The Boston Globe dubbing Tel Aviv “the World's Gayest City” and Out Magazine calling it “the Gay Capital of the Middle East.” Jun9.2017 htips://mfa.gov.il» israelexperience» lifestyle» pages» те... + Tel Aviv hosts largest gay parade ever held in the Middle East (О Anonymous (1D: QUEENS) 55 07/01/24 (Thu)17-50:55 No 328373101 » zsszsszaosz File: say eus png (181 KB, 7404749) Sexual Orientation and Behavior of Adult Jews in Israel and the Association With Risk Behavior Zohar Mor 1, Udi Davidovich 2 Affiliations 4- expand PMID: 26754157 DOI: 10.1007/510508-015-0631-0 Abstract Estimating the size of key risk groups susceptible to HIV/sexually transmitted diseases (STI) is necessary for establishment of interventions and budget allocation. This study aimed to identify various dimensions of sexual orientation and practices in Israel, and correlate the findings with sexual risk behavior (SRB). It used a random representative sample of the Jewish population aged 18-44 years who completed online questionnaires regarding their self-identified sexual orientation, attraction and practices, and SRB. Concordant heterosexuals were those who self-reported heterosexual identity, were attracted and had sex only with the opposite gender. National estimates regarding prevalence of gay, lesbian, and bisexual men and women were based onthe civil census. The sample included 997 men and 1005 women, of whom 11.3 and 15.2 % were attracted to the same-gender, 0.2 ond 0.7 % reported lifetime same-gender encounter while 02 and 48 % self-identified as gay or bisexual men and lesbian or bisexual women, respectively. The ‘estimated population of self-identified Jewish gay or bisexual men and lesbian or bisexual women aged 18-44 in Israel was 94,176, and 57,671, respectively. SRB was more common among self- identified gays or bisexual men and among discordant heterosexual men and women. Those who reported same-gender sexual practices reported greater SRB than those who only had opposite- gender encounters. interestingly, SRB among discordant heterosexuals was associated with same- sex behavior rather than attraction. Health practitioners should increase their awareness of sexual diversity among their clientele, and should recognize that risk For HIV/STI may exist among self- identified heterosexuals, who may not disclose their actual sexual attraction or practices. Keywords: Bisexual; Gay men; Israel; Lesbians; Sexual orientation. Around 10% or awen mates are romosexual. The jewish community is rife үйін homosexuality. ‘Aico koop in mind that Talmudic judaism beliavoc that god doocn' have any gendor. That god raprosonts the urion of male and female. They even havea name forthe female aspect of god called Shekhinah. They also believe that Atam was noi the frst human, but was created beside a female caled Lith. https:/en.wikipedia org/vikiShekhineh. They belleve tnat untying tne sexes s getting cicser to god. That's probably the root cause oll ins transgenderism stu. Not Anudda Shoah! It gets worse. 106 W: LIKE TO THINK Of ourselves as in the driver’s seat, choosing where to go, whether to speed up or slow down, when to switch lanes. We make the decisions and bear the consequences. This is a convenient, even necessary belief. If we jettison the notion of free will, the laws that hold people accountable for their actions begin to crumble. The world becomes an unruly or even terrifying place. Alien beings that turn us into zombies, bloodthirsty vampires, and sex-crazed La sz robots are standard sci-fi fare precisely because they evoke the horror of losing control or, worse, becoming slaves to creatures bent on exploiting us for their own gain. So it’s disconcerting to think that an invisible passenger might also have a hand on the steering wheel, vying to move us in one direction when we’d 2 4 (YU rather go another. When we let up on the accelerator, an unseen foot presses f ES 0 N harder. | ) Parasites are like that invisible passenger. Adept at outwitting our immune | A systems, they sneak aboard our bodies and then the devilry begins. They cause rashes, lesions, aches, and pain. They eat us from the inside out; use us to incubate their young; sap our energy; blind, poison, maim, and sometimes kill , РГ ( us. But that’s not the full extent of their clout. Some parasites have another trick / ү up their sleeves—an awesome hidden power that astounds and confounds even scientists who study them for a living. Simply stated, these parasites are masters of mind control. Whether as tiny as a virus or as big as a six-foot-long tapeworm, they have found all kinds of devious methods to manipulate the How Tiny Creatures Manipulate behavior of their hosts, and that includes, many researchers now strongly ерес Bamans. Our Behavior and Shape Society and then the devilry begins Devil1 devilry "€ Devil3 Devil4 What are [devils]? Are parasites devils? Anonymous (ID: 6 Ey) = 09/27/21(М0п)18:39:06 No.341161329 » >>341161567 : 320px-Lambton Worm.jpg (68 KB, 320x465) = Be >-341160425 >Lambton worm >https://en.wikipedia.org/wiki/Lambton_Worm >The story states that the young John Lambton was a rebellious character who missed church one Sunday to go fishing in the River Wear. In many versions of the story, while walking to the river, or setting up his equipment, John receives warnings from an old man (or a witch — depending on who tells the story) that no good can come from missing church. >John Lambton does not catch anything until the church service finishes, at which point he fishes out a small eel- or lamprey-like creature with nine holes on each side of its salamander-like head. Depending on the version of the story, the worm is no bigger than a thumb, or about 3 feet (90 centimetres) long. In some renditions it has legs, while in others it is said to more closely resemble a snake. >At this point, the old man returns, although in some versions it is a different character. John declares that he has "catched [caught] the devil" and decides to dispose of his catch by discarding it down a nearby well. The old man then issues further warnings about the nature of the beast. Holy shit https://en.wikipedia.org/wiki/Lindworm 107 Could the word ‘devil’ be replaced with the word ‘parasite’ in all of the following verses without losing context? Mat 9:32 Mat 9:33 Mat 11:18 Mat 12:22 Mat 15:22 Mat 17:18 Mar 5:15 Mar 5:16 Mar 5:18 Mar 7:26 Mar 7:29 Mar 7:30 Luk 4:33 Luk 4:35 Luk 7:33 Luk 8:29 Jhn 8:48 As they went out, behold, they brought to him a dumb man possessed with a devil. And when the devil was cast out, the dumb spake: and the multitudes marvelled, saying. It was never so seen in Israel. For John came neither eating nor drinking, and they say, He hath a d Then was brought unto him one possessed with a devil, blind, and dumb: and he healed him, insomuch that the blind and dumb both spake and saw. And, behold, a woman of Canaan came out of the same coasts, and cried unto him, saying, Have mercy on me, O Lord, thou Son of David; my daughter is grievously vexed with a devil. And Jesus rebuked the devil; and he departed out of him: and the child was cured from that very hour. And they come to Jesus, and see him that was possessed with the devil, and had the legion, sitting, and clothed, and in his right mind: and they were afraid. And they that saw it told them how it befell to him that was possessed with the devil, and а/о concerning the swine. And when he was come into the ship, he that had been possessed with the devil prayed him that he might be with him. The woman was a Greek, a Syrophenician by nation; and she besought him that he would cast forth the devil out of her daughter. And he said unto her, For this saying go thy way; the devil is gone out of thy daughter. And when she was come to her house, she found the And in the synagogue there was a man, which had a spirit of an unclean devil, and cried out with a loud voice, And Jesus rebuked him, saying, Hold thy peace, and come out of him. And when the devil had thrown him in the midst, he came out of him, and hurt him not. For John the Baptist came neither eating bread nor drinking wine; and ye say, He hath a devil. (For he had commanded the unclean spirit to come out of the man. For oftentimes it had caught him: and he was kept bound with chains and in fetters; and he brake the bands, and was driven of the devil into the wilderness.) Then answered the Jews, and said unto him, Say we not well that thou art a Samaritan, and hast a devil? Jhn 8:49 Jhn 8:52 Jhn 10:20 Jhn 10:21 Jhn 13:2 Act 13:10 Eph 4:27 Eph 6:11 Heb 2:14 Jas 4:7 1Pe 5:8 1Jo 3:8 1Jo 3:10 Luk 9:42 Luk 11:14 Jhn 7:20 108 Jesus answered, | have not a devil; but | honour my Father, and ye do dishonour me. Then said the Jews unto him, Now we know that thou hast a devil. Abraham is dead, and the prophets; and thou sayest, If a man keep my saying, he shall never taste of death. And many of them said, He hath a devil, and is mad; why hear ye him? Others said, These are not the words of him that hath a devil. Can a devil open the eyes of the blind? having now put into S son, to betray him; And supper being ended, the d the heart of Judas Iscariot, Sim And said, O full of all subtilty and all mischief, thou child of the devil, thou enemy of all righteousness, wilt thou not cease to pervert the right ways of the Lord? Neither give place to the devil. Put on the whole armour of God, that ye may be able to Forasmuch then as the children are partakers of flesh and blood, he also himself likewise took part of the same; that through death he might destroy him that had the power of death, that is, the devil; Submit yourselves therefore to God. Resist the devil, and he will flee from you. Be sober, be vigilant; because your adversary the devil, as a roaring lion, walketh about, seeking whom he may devour: He that committeth sin is of the devil; for the devil sinneth from the beginning. For this purpose the Son of God was In this the children of God are manifest, and the children of the devil: whosoever doeth not righteousness is not of God, neither he that loveth not his brother. And as he was yet a coming, the devil threw him down, and tare him. And Jesus rebuked the unclean spirit, and healed the child, and delivered him again to his father. And he was casting out a devil, and it was dumb. And it came to pass, when the devil was gone out, the dumb spake; and the people wondered. The people answered and said, Thou hast a devil: who goeth about to kill thee? What are [demons]? [devil = demon] In ancient times, what were [parasites] called? Are demons considered clean or [unclean]? Are parasites considered clean or [unclean]? Do demons get inside of your body? Do parasites get inside of your body? Do demons manipulate your behavior? Do parasites manipulate your behavior? Do demons take possession of your body? Do parasites take possession of your body? Does fasting “cast out demons”? (M17.21) Does fasting “cast out parasites”? Do demons try to make you commit suicide? Do parasites try to make you commit suicide? Do Old Testament Laws prevent possession from demons? Do Old Testament Laws prevent possession from parasites? Why do the infected use ‘they/them’ as pronouns? Who is the Gerasene demoniac? (L8.32) ["My name is Legion, for we are many"] After the worms were exercised, what did they infect next? Will parasites kill the host in order to continue its life-cycle? Do worms have a history of drowning their hosts? Spinochordodes tellinii Spinochordodes tellinii is a parasitic nematomorph hairworm whose larvae develop in grasshoppers and crickets. This parasite is able to influence its host's behavior: once the parasite is grown, it causes its grasshopper host where the grasshopper will likely drown. Family: Chordodidae Genus: Spinochordodes Kingdom: Animalia Species: S. tellinii What happened to the swine? Were the pigs possessed by demons? Or were the pigs possessed by parasites? Is the word 'parasite' synonymous with the word 'demon'? 109 Got a little out of my comfort zone and wore an outfit that had been hiding in my closet for a year. It was so much fun <2 Ф Bean ses? (they/them xe/xem) ID in captions Could a demon be "cast out" of a host by administering anti-parasite treatments? "Seek, therefore, a large trailing gourd, having a stalk the length of a man; take out its inwards and fill it with water from the river which the sun has warmed. Hang it upon the branch of a tree, and kneel upon the ground before the angel of water, and suffer the end of the stalk of the trailing gourd to enter your hinder parts, that the water may flow through all your bowels. Afterwards rest kneeling on the ground before the angel of water and pray to the living God that he will forgive you all your past sins, and pray the angel of water that he will free your body from every uncleanness and disease. Then let the water run out from your body, that it may carry away from within it all the unclean and evil-smelling things of Satan. And you shall see with your eyes and smell with your nose all the abominations, and uncleannesses which defiled the temple of your body; even all the sins which abode in your body, tormenting you with all manner of pains. I tell you truly, baptism with water frees you from all of these. Renew your baptizing with water on every day of your fast, till the day when you see that the water which flows out of you is as pure as the river's foam. Then betake your body to the coursing river, and there in the arms of the angel of water render thanks to the living God that he has freed you from your sins. And this holy baptizing by the angel of water is: Rebirth unto the new life. For your eyes shall henceforth see, and your ears shall hear. Sin no more, therefore, after your baptism, that the angels of air and of water may eternally abide in you and serve D "- HELF QUICKNAY арм. OPTIONS мер BLUE LETTER BIBLE | an Verse or Word(s) La CLICK TO CHANGE Pf ~ « < Y > » "coPY COPYOPTIONS E STRONG'S FORMAT BY: & VERSE (Х/ PARAGRA Rom 7:20 Now if | do that | would not, it is no more | that do it, but sin that dwelleth in me. Does sin "live" inside the body? Is the word 'sin' and the word 'parasite' synonymous? Q & kingjamesbibleonline.org/2-Maccabees-Chapter-9/ 9 бо that the worms rose ир out of the body of this wicked man, and whiles he lived in sorrow and pain, his flesh fell away, and the filthiness of his smell was noisome to all his army. 2 Maccabees 9:9 KJV verse detail 110 Do worms come from hell? Mar 9:47 And if thine eye offend thee, pluck it out: it is better for thee to enter into the kingdom of God with one eye, than having two eyes to be cast into hell fire: Do demons come from hell? Is hell underground? Do worms come from underground? Mar 9:48 Where their worm dieth not, and the fire is not quenched Іп 2012, in response to Günter Grass's poem "Was gesagt werden muss" ("What Must Be Said") which criticized Israel's nuclear weapons program, Israeli poet and Holocaust survivor Itamar Yaoz-Kest published a poem entitled "The Right to Exist: a Poem-Letter to the German Author" which addresses Grass by name. It contains Е If you force us yet again to descend from the face of the Earth to the depths of the Earth — let the Earth roll toward the Nothingness." INTE Tae journalist Gil Ronen saw this poem as referring to the Samson Option, which he described as the strategy of using Israel's nuclear weapons, "taking out Israel's enemies with it, possibly causing irreparable damage to the entire world."[34] Why would a jew [an infected] claim he does not want to return to 'underground'? [depths of the Earth] Do worms come from underground? What did the ancient Greeks call the 'underground'? Who is Yaldabaoth? What is Sheol? | It gets worse. 111 HELP QUICKNAY ADY. OPTIONS KJV BLUE LETTER BIBLE Trl ата Мегзе ог Word(s) км. ІРІ CLICK TO CHANG! COPY COPY OPTIONS E STRONG'S Ш RED-ETI сеп 3:14 And the LORD God said unto the serpent, Because thou hast done this, thou art cursed above all cattle, and above every beast of the field: upon thy belly shalt thou go, and Do serpents eat dust? [Dust of the Earth = dirt] Do serpents eat dirt or do worms eat dirt? Can the Latin term 'serpens' be translated into the English terms ‘snake’, 'dragon' ог 'WORM'? Is the Serpent from Genesis actually a worm? a" ре ere HELP QUICKNAY ADY. OPTIONS pus Lodi it cia mms KN. « < ¥ > » СОРУ COPY OPTIONS Ш STRONG'S FORMAT BY: «Әуезе (OJ PARAGR) Lev 15:19 ‘| And if a woman have an issue, and her issue in her flesh be blood, she shall be put apart seven days: and whosoever toucheth her shall be unclean until the even. Why does the Bible consider menstruation to be unclean? Can [unclean] parasites be transmitted through blood? Why does the Bible consider nocturnal ejaculations and sex to be unclean? Can [unclean] parasites be transmitted through semen? o тт HELP QUICKNAY ADY. OPTIONS Im JE LETTE IBLE ; a» runc CO KIV, 7» = « < ¥ > » COPY COPYOPTIONS Ш STRONG'S FORMATBY: Verse (©) PARAGI Deu 23:10 If there be among you апу man, that is not clean by reason of uncleanness that chanceth him by night, then shall he go abroad out of the camp, he shall not come within the camp: Deu 23:11 But it shall be, when evening cometh оп, he shall wash himself with water: and when the sun is down, he shall come into the camp again. m en HELF QUICKNAY ADY. OPTIONS T— BLUE LETTER BIBLE > жа. ку · асое « < V > » COPY COPYOPTIONS Ш STRONG'S ҒОВМАТВҮ: @/VERSE (C)PARAG Lev 15:18 The woman also with whom man shall lie with seed of copulation, they shall both bathe themselves in water, and be unclean until the even. 112 Why does the Bible consider pork and shellfish to be unclean? Are pork and shellfish notorious parasite vectors? жа BLUE LETTER BIBLE = pape Ter | ІРІ KJV CLICK TO CHAN « < Y > » ЯСОРҮ COPYOPTIONS Ш STRONG'S FORMAT BY: NERSE (S) PARAC Lev 11:7 And the swine, though he divide the hoof, and be clovenfooted, yet he cheweth not the cud; he is unclean to you. HELF QUICKNAY ADY. OPTIONS A BLUE LETTER BIBLE 3 KJV Verse or Word(s KJV >» CLICK TO CHAN / 4 < ҰЯ» » COPY COPYOPTIONS Ш STRONG'S FORMATBY. Q/VERSE (S) PARAC iN Nh 7 Lev11:12 Whatsoever hath no fins nor scales in the waters, that shall be an abomination unto you. Body riddled with parasites as a result of eating raw pork for 10 years. Why does the Bible say sodomy is an abomination? Are homosexuals riddled with parasites? Is anal sex one of the most common methods of parasitic infection? ums ж m Е 4 HELP QUICKNAY ADY. OPTIONS ж. ЫН... |с |Б 4 < y > » cor COPYOPTIONS M STRONG'S FORMATBY. QJ VERSE (©) PARAG Lev 18:22 Thou shalt not lie with mankind, as with womankind: it /s abomination. What does the Bible say about drinking blood? Does consuming blood transfer parasites? m HELF QUICKNAY ADY OPTIONS ae BLUE LETTER BIBLE нини ІРІ KJV CLICK TO CHANI 4 < Ж > » соғу COPYOPTIONS Ш STRONG'S FORMATBY. © VERSE [S) PARAG Lev 17:10 ! And whatsoever man there be of the house of Israel, or of the strangers that sojourn among you, that eateth any manner of blood; | will even set my face against that soul that eateth blood, and will cut him off from among his people. Are some yeasts considered to be parasites? Anonymous ID:woIY6ACk Sat 12 Oct 2019 23:07:53 No.229679032 22229659291 Beware the yeast of the pharasies 113 Why did the Bible consider mildew to be unclean? Is mildew a parasite? Leviticus 14 33 The LORD said to Moses and Aaron, 34 “When you enter the land of Canaan, which I am giving you as your possession, and | put a spreading mildew in a house in that land, 35 the owner of the house must go and tell the priest, 1 have seen something that looks like mildew in my house.’ 36 The priest is to order the house to be emptied before he goes in to examine the mildew, so that nothing in the house will be pronounced unclean. After this the priest is to go in and inspect the house. 37 He is to examine the mildew on the walls, and if it has greenish or reddish depressions that appear to be deeper than the surface of the wall, 38 the priest shall go out the doorway of the house and close it up for seven days. 39 On the seventh day the priest shall return to inspect the house. If the mildew has spread on the walls, 40 he is to order that the contaminated stones be torn out and thrown into an unclean place outside the town. 41 He must have all the inside walls of the house scraped and the material that is scraped off dumped into an unclean place outside the town. 42 Then they are to take other stones to replace these and take new clay and plaster the house. 43 "If the mildew reappears in the house after the stones have been torn out and the house scraped and plastered, 44 the priest is to go and examine it and, if the mildew has spread in the house, it is a destructive mildew; the house is unclean. 45 It must be torn down—its stones, timbers and all the plaster—and taken out of the town to an unclean place. 46 "Anyone who goes into the house while it is closed up will be unclean till evening. 47 Anyone who sleeps or eats in the house must wash his clothes." Job 2:7. 1 So went Satan forth from the presence of the LORD, and smote Job with sore boils from the sole of his foot unto his crown. Job 7:5 My flesh is clothed with worms and clods of dust; my skin is broken, and become loathsome. Are animals considered spoils of war? So why would God command Saul to kill all of the animals of the Amalekites? Were the Amalekites a nation of sorcerers? Is magic associated with parasites? If the Amalekites and their animals were infected, would God's command make complete sense? m 7 22 z AD NS "X aa BLU E LETTER BIBLE Verse or Word(s) ІРІ KJV CLICK TO CHAN( « < ¥ > » E COPY COPYOPTIONS Ш STRONG'S FORMATBY: Wrerse (© PARAG 1Sa 15:3 Now go and smite Amalek, and utterly destroy all that they have, and spare them not; but slay both man and woman, infant and suckling, ox and sheep, camel and ass. 114 And Jesus milked an ewe which was feeding among the grass. And he put the milk upon the sand made hot by the sun, saying: "Lo, the power of the angel of water has entered this milk. And now the power of the angel of sunshine will enter it also." And the milk became hot by the strength of the sun. "And now the angels of water and of sun will join with the angel of air." And lo, the vapor of the hot milk began to rise slowly into the air. "Come and breathe in by your mouth the strength of the angels of water, of sunshine, and of air, that it may come into your body and cast out the Satan from you." And the sick man whom Satan tormented did breathe within himself, deeply, the rising whitish vapor. "Straightway will Satan leave your body, since for three days he starves and finds no food within you. He will come out of you to satisfy his hunger by the hot steaming milk, for this food finds favor in his sight. He will smell its smell, and will not be able to resist the hunger which has tormented him three days already. But the Son of Man will destroy his body, that he may torment none else again." Then the sick man's body was seized with an ague, and he retched as though he would vomit, but he could not. And he gasped for air, for his breath was spent. And he fainted on the lap of Jesus. "Now does Satan leave his body. See him." And Jesus pointed to the sick man's opened mouth. And then they all saw with astonishment and terror that Satan was coming out from his mouth in the shape of an abominable worm, straight towards the steaming milk. Then Jesus took two sharp stones in his hands and crushed the head of Satan, and drew out from the sick man all the body of the monster which was almost as long as the man. When the abominable worm came out of the sick "For I tell you truly, evils and dangers innumerable lie in wait for the Sons of Men. Beelzebub, the prince of all devils, the source of every evil, lies in wait in the body of all the Sons of Men. He is death, the lord of every plague, and taking upon him a pleasing raiment, he tempts and entices the Sons of Men. Riches does he promise, and power, and splendid palaces, and garments of gold and silver, and a multitude of servants, all these; he promises renown and glory, fornication and lustfulness, gluttony and wine-bibbing, riotous living, and slothfulness and idle days. And he entices every one by that to which their heart is most inclined. And in the day that the Sons of Men have already become the slaves of all these vanities and abominations, then in payment thereof he snatches from the Sons of Men all those things which the Earthly Mother gave them so abundantly. He takes from them their breath, their blood, their bone, their flesh, their bowels, their eyes and their ears. And the breath of the Son of Man becomes short and stifled, full of pain and evil-smelling, like the breath of unclean beasts. And his blood becomes thick and evil-smelling, like the water of the swamps; it clots and blackens, like the night of death. And his bone becomes hard and knotted; it melts away within and breaks asunder, as a stone falling down upon a rock. And his flesh waxes fat and watery; it rots and putrefies, with scabs and boils that are an abomination. And his bowels become full with abominable filthiness, with oozing streams of decay: and i i have their habitation there. And his eyes grow dim, till dark night enshrouds them, and his ears become stopped. like f all shall the erring Son of Man lose life. For he kept not the laws of his Mother, and added sin to sin. Therefore, are taken from him all the gifts of the Earthly Mother: breath, blood, bone. flesh, bowels, eyes and ears, and after all else, life, with which the Earthly Mother crowned his body. 115 Protocol master 03/12/22(Sat)13:23:22 Мо.31249983 LJ b: 3982437435 ае4с064е88 b.jpg (149 KB, 1024x683) >>31249889 >No need to get defensive The devil prowls around like a lion, looking for people to devour. They go on these threads and lie constantly to keep people in the cycle of fear, uncertainty, and doubt. Doubt, is without doubt, their greatest weapon. But the time is coming where there can be no more doubt. The wheat is being separated from the chaff and the lukewarm in spirit will be cast into the fire alongside the chaff. >| was practically an atheist before cleansing The black goo and the parasites are demonic in nature. They suppress spirituality. Fill your thoughts with darkness, and torture you. They incite you to sin and make you feel iredeemable when you give in. Sin, of which, is only such a strong temptation because of the inner uncleanness. These parasites are literal demons. People need to know the truth, even if most choose to reject it. Not many will do what it takes. Water fasting is challenging. Doing coffee enemas appears emasculating. Taking a mineral powder sounds like woo-woo. Now what if | told you all three of these thoughts are demonic in nature? The parasites are intelligent. They fear their annihilation and can alter your perception to keep you in a cycle of misery. Many people you meet are, in fact, possessed If parasites are literal demons, and if parasites can enter a host through sex, and if parasites can take years before they seize control over a host, and if your wife was not a virgin when you met her, then could the following horror story not only be possible, but also quite commonplace: СА Steve Horror story concept: you fall in love with a woman, get married, and have a son. Shortly following your son's eighth birthday, your wife is replaced by a demon who impersonates her appearance and mannerisms perfectly, except now she wants to turn your son into а girl. Forty-nine days — How long did the Buddha fast? forty-nine days The Buddha seated under the HELF uic v À n | BLUE LETTER BIBLE — ee Rajayatana tree had been fasting for forty-nine days by then. They brought rice cakes ER and honey to help him break his fast. « < Y > » СОР COPYOPTIONS Ш STRONG'S FORMAT BY: < vensE (SN) PARAC Then was Jesus led up of the Spirit into the wilderness to be tempted of the devil. Mat 4:2 And when he had fasted forty days and forty nights, he was afterward an hungred. 22229657155 I've put serious thought into this in the past. In the bible it is written that (paraphrasing) "Jesus went out into the wilderness for 40 days during which time he did not eat for the entire 40 days in order to do cast satan out" Starving oneself is a very old method of dealing with parasites. If you arent eating food then the parasites dont get to eat either and it comes down to they die out or you do. 116 Did the ancient Chinese believe that parasites are demons? What are Gu Demons? LINK What is a wetiko? THE Wetiko is more accurately described as simply Wetiko. Like a trans-dimensional plague, It is simultaneously my personal tormentor and a metaphysical virus that has spread around the world..infecting and feeding upon most, if not all, human beings alive today. Three Corpses From Wikipedia, the free encyclopedia The sanshi =P "Three Corpses" or sanchong = "Three Worms" аге a Daoist physiological belief that demonic creatures live inside the human body, and they seek to hasten the death of their host. These three supernatural parasites allegedly enter the person at birth, and reside in the three dantian "energy centers", respectively located within the head, chest, and abdomen. After their human host dies, they are freed from the body and become malevolent ghosts. The pernicious Three Corpses/Worms work to harm their host's health and fate by initiating Sicknesses, inviting other disease-causing agents into the body, and reporting their host's transgressions to the gods. The Three Corpses are supposed to keep records of their host's misdeeds, ascend to tian "heaven" bimonthly on the night of Chinese sexagenary gengshen AQ Æ "57th of the 60-day cycle" while the host is sleeping, and file reports to the Siming 2195 ( T "Director of Destinies" who deducts a certain number of days from the person's life for each lf. N misdeed. One way of avoiding this bureaucratic snitching is to stay awake for the entire 55% gengshen day and night, thus preventing the Three Corpses from leaving one's body (a belief - : cee Ва Sanshi =P "Three Corpses” illustration from the 5 later assimilated into the Japanese Koshin BF tradition). ja (c. 9th century) Chu sanshi jiuchong baoshengjing E& For a Daoist adept to achieve the longevity of a xian "transcendent; immortal", it was ЕРЛӘНЕ necessary to expel the Three Corpses from the body. Since these evil spirits feed upon decaying matter produced by grains being digested in the intestines, the practice of bigu “abstinence from grains and cereals" is the first step towards expelling them. Bigu alone will not eliminate the Three Corpses, but weakens them to the point where they can be killed with waidan alchemical drugs such as cinnabar, and ultimately eliminated through neidan meditation techniques. pu A" Food Pyramid “Since these evil spirits feed upon decaying matter produced by grains..." Fin, voguna cheese —— Neat, EN нА ( Б 2-3 Servings Vegetable Group y 3. Fruits Group grains => | * A feeling of pressure in the head, chronic migraine type headaches, weakened vision, poor hearing, unusual phantom Peng Ju Possession Symptoms smells and tastes, blotches and abnormalities upon the skin of the face, excessive amounts of mucous or spontaneous flowing of fluid from the eyes, bad breath Peng Jiao Possession Symptoms * Digestive issues, weakness in the back and knees which limits mobility, weakness and cold in the lower abdomen due to damage to the lower Dan Tien, nocturnal emissions, excessive feelings of desire and lust, addictive behaviors Peng Zhi Possession Symptoms e Pain and swelling in the chest and hypochondriac region of the body, shortness of breath, spasms in the body, an obsession with sensual pleasures, depression, suicidal tendencies 117 The location of the three worms also corresponds to three key locations upon the body which practitioners of alchemical meditation will be more than familiar with. These locations are known as the three of the key ‘clipping passes’; areas of difficulty for those involved in Daoist meditation. The Peng Zhu clipping pass known as Yu Zhen ^ The Peng Zhi clipping - pass known as Shen Dao Pineal gland Pituitary gland Visudha EA х- as Thyroid gland The Peng Jiao clipping pass is within the sacrum Anahata chakra (Heart) Thymus gland Manipurana chakra (pancreas) Adrenal gland Swadhisthana chakra (Testis & ovary) ы “ Gonads gland What are Chakras? Muladhara chakra Prostate & Chakras? = Glands? (Grounding & physical stemina) ^ Fallopian tube Do parasites harvest gland secretions? By controlling human gland secretions, can a parasite control the human? Why does the worm coil up the kundalini? What is the Caduceus? COSMIC ENERGY ENTRY COSMIC ENERGY INPUT (FEMALE) (MALE) vampire channel Entities with a trunk B and suckars Snail with organs of the hola Field parasites on and under legs G6 “There are beings in the spiritual realms for whom anxiety and fear emanating from human beings offer welcome food. When humans have no anxiety and fear, then these creatures starve... If fear and anxiety radiates from people and they break out in panic, then these creatures find welcome nutrition and they become more and more powerful. These beings are hostile towards humanity. 118 Hollywood has convinced you that demons have claws, horns, fangs, poison, and look like this: But do demons actually look like this: ...Well, ummm, for once, | guess Hollywood’s depiction was actually very accurate. Cat-Demon takes possession of a man by inserting worm into man’s anus 130 Detail of man near the top of the % decorative column mentioned in the caption for Figure 129, showing how the demonic tendril is inserted into the man's anus The tendron from the demonic terminates in the body of the human figure. Do parasites feed on human blood? What does pop culture mean by this: "You're up my anus" "| drink their blood." LINK Osculum infame From Wikipedia, the free encyclopedia Osculum infame is the name of a witch's supposed ritual greeting upon meeting with the Devil. The name means The Shameful Kiss, or The Kiss of Shame since it involved kissing the devil's anus, his other mouth. According to folklore, it was a 9 і Тһе osculum infame illustrated іп this kiss that allowed the Francesco Mana GUazzo's Devil to seduce women. Compendium maleficarum of 1608 The pamphlet provided the first descriptions of the osculum infame to the English population?! Belief held that the Devil demanded the kiss of shame in forms other than human, including rams, black cats, and toads. Errores Haereticorum, a medieval tract, claims that the 131 The role could also be Why do witches have black cats? reversed whereby the witch was the recipient of the kiss.!5] What is Toxoplasmosis? Modern version of Osculum Infame: LINK 120 What are "Generational Spirits"? Are they passed from generation to generation? Can parasites be passed from generation to generation? What is another name for Generational Spirits? What are witches’ cats called? Can demons possess non-human mammals? Can parasites infect non-human mammals? Can those parasites allow the Hive Mind to communicate to humans through the host animal? What are "familiars"? Wy N N N What is Stranger Things? Did the Parasite begin by infecting animals [familiars]? Did the Parasite use the infected animals to infect humans? When the Parasite infected Billy, did the Parasite gain control over him? Did the parasite use Billy to spread more parasites to others? Truth disguised as fiction? 121 Did the cravings of the infected hosts begin to change? Did the human hosts begin to crave the taste of feces? Elements of history disguised as fiction? Why is Homosexuality so protected? If humans are infected with parasites, could the parasites influence the hosts to crave feces? Is feces-consumption one of the most commons way to transmit parasites? Over several weeks, the parasites migrate through host tissue and develop into adult worms inside the blood vessels of the body. Once mature, the worms mate and females produce eggs. Some of these eggs travel to the bladder or intestine and are passed into the urine or stool. CDC - Schistosomiasis - Disease ша www.cdc.gov/parasites/schistosomiasis/disease.html Little Crawlers dude's finger on /b/ after fingering his girlfriends ass. also posted a photo of them on his tongue Malte Mueller I’ve Contracted My Third Gastrointestinal Parasite From Rimming—And | Can’t Be The Only Gay Man Suffering Do jews have a scat fetish? LINK 122 [Homosexuality >>> Feces transmission >>> Parasite infection] The head of the UK's Environment Agency says that people need їо be ‘less squeamish’ about drinking "toilet-to-tap" water from treatment plants, as countries and states around the world move towards recycling sewage. Why would the government be so slow to put an end to this: AUSTRALIA Home | U.K. | U.S. | News | World News | Sport | TV&Showbiz | Femail |7777 Science Latest Headlines | Zika Virus | Depression | Cancer US meat supply is riddled with feces, doctors claim in a lawsuit against the government in a bid to wipe fecal matter from our food * The government maintains a ‘zero tolerance’ policy on feces in food * The Physicians Committee for Responsible Medicine says that only applies to ‘visible’ fecal matter “ They filed a lawsuit against the USDA on Tuesday calling for tighter regulations ==) Bill Gates @ - @BillGates | drank water made from human feces. According to a Sunday op-ed in The Times, Sir James Bevan writes that "drinking recycled sewage is the future." RESTAURANTS Fecal bacteria found in drinks at UK branches of McDonald's, Burger King and KFC M EDT | UPDATED THU, JUL 20 2017-8:21 AM EDT PUBLISHED THU, JU David Reid Se f 9 in mà &DAVYREID73 UP NEXT | Shark Tank 7:00 PM ET Listen Б found in ice at McDonald's, КЕС and Burger King in the U.K., levels were found et Burger King and KFC. TRENDING NOW a make it fa" LIFE BREAKING NEW. ; let + Ls Wendy's pe To “Pooping” чыз Whati rh e drinking in Chili For Over 2 Years [44 MSNBC | water? If you live in one of ——— N these states, it might soon be recycled sewage Published Fri, Aug 19 2022 12:12 PM EDT Annika Kim Constantino Home | U.K. | News | The Queen | Sports | U.S. Showbiz | Australia | Femail 7 s @ANNIKAKIMC Latest Headlines | Monkeypox | Covid-19 | CDC | WHO Big Muck! Investigation finds FAECES on every McDonald's touchscreen unit Share f Y tested as fast food chain comes under scrutiny for 'not using strong enough disinfectant' + Touchscreens are used before eating food, often without washing hands “ The samples also found traces of bacteria that can cause blood poisoning + Expert at London Metropolitan University said findings are worrying By VANESSA CHALMERS HEALTH REPORTER FOR MAILONLINE PUBLISHED: 09:21 EDT, 28 November 2018 | UPDATED: 11:21 EDT, 29 November 2018 123 Is your roommate gay? = = NEWSLETTER MkzniCcALNEWSTODAY . Fecal matter found on more than 60% of toothbrushes in shared bathrooms Sharing a bathroom with other people can have its downfalls — wet towels all over the floor, toilet seats left up, and that person who never replaces the toilet paper. But a new study finds there is one communal bathroom issue that is much more pressing: fecal contamination on toothbrushes. explains study author Lauren Aber, a graduate student of Quinnipiac University in Hamden, CT. r/Coprophiles ujpa 57d © NSFW Breath after swallowing shit ? What is Coprophagia? 15 Coprophagia caused Бу a parasite? What is Giardia? What is Isospora? I've a question guys; after swallowing a lot of poop, does your breath smell like poop? Вс I've tried to smell myself and | never smell like poo, but If it does; how much does it take to disappear, after brushing your tongue and teeth? Qs Ом d) BEST COMMENTS v e dd «58d | always brush my teeth when I've eaten ,| love having а solid piece in my mouth for a while then swallowing it hole with some water ,| also the after taste when | burp much later reminding me of my kinky fetish ӘҢ SReply