& Second Edition
1. IMMUNE exp e ————Á—Ó 4
2S ERE ВВА Масата ооло tere een sgn ancora eae 22 3. ЅҮМРТОМ5 .................... дДҙҘҙә1 М... аннан 26 4. РАВАЅІТЕС......... РИ... анаа КТ 30 ЖАаНПҺ4--- ЖҰРТ OM оо, , МЕТ 60 6. THE МОВКЕНФ, ЕЛ M 0 А .522.).......................................... 89 7. THE DRONES.............. ДЧ E ЛЫСЫ ененин 132 8. THE QUEEN Ы ҚЫН аа ОКК ........... 140 9. TRUTH AS НЕНОЙ eno OO Oe ИЛ ао a oaaao aooe: 148 10. КА МАМА КАА ІЛ/ЕВАМА............2. емле йа ме ымен sensen немене setot nenat 153 11 DEWORMING а 157 12 TREATMENTS н. 165
NOUN
1. anorganism that lives in or on an organism of another species (its host) and benefits by deriving nutrients at the other's expense:
"the parasite attaches itself to the mouths of fishes" - [more]
Taxonomic range [edit]
Parasitism has an extremely wide taxonomic range, including animals, plants, fungi, protozoans, bacteria, and уігиѕеѕ 155
Head DNA Ш | Collar Protein Tail Long Tail
Fibres
2D 3D
Base Plate
1. IMMUNE SYSTEM
Cats have a schedule for routine treatment of parasites. Dogs have a schedule for routine treatment of parasites. Horses have a schedule for routine treatment of parasites. Cattle have a schedule for routine treatment of parasites. Chickens have a schedule for routine treatment of parasites.
All mammals that interact with humans have a schedule for routine treatment of parasites.
Except for one...
Are you a mammal?
Do you interact with humans?
When was the last time you were prescribed a schedule for a routine treatment of parasites?
The immune system of all mammals naturally fights off parasites.
Yet, all mammals [except one] are still given a schedule for routine treatment of parasites.
But how does the human immune system compare with the immune system of other mammals? Reconcile.
Is Vitamin C necessary for a healthy immune system? Which is the only mammal incapable of producing its own Vitamin C? What is 'hypoascorbemia'?
If humans cannot naturally produce Vitamin C, would humans be more susceptible to parasite infection than any other mammal?
If humans are more susceptible to parasite infection than all other mammals, then why are humans the only mammal which is not given a schedule for routine treatment of parasites?
Logical thinking.
№
Female
“=e
Egg-mass
Does Vitamin C deficiency result in depression, schizophrenia, Alzheimer’s disease, gastrointestinal disease, fatigue, death, and even cancer?
Preventive and Therapeutic Potential of Vitamin C in... https://pubmed.ncbi.nlm.nih.gov/30074145
In the past few decades, scientists have revealed that the deficiency of vitamin C may lead to motor deficit, cognitive impairment and aberrant behaviors, whereas supplement of vitamin C
disorder (MDD), schizophrenia, anxiety and Alzheimer's disease (AD) Author: Qian-Qian Han, Tian-Tian Shen, Fan Publish Year: 2018
Do these symptoms result from a vitamin deficiently, or are these symptoms resulting from parasites rapidly multiplying in a host with an immune system weakened from vitamin deficiency?
What is the [real] cause of depression, schizophrenia, Alzheimer's disease, gastrointestinal disease, fatigue, death, and cancer?
It gets worse.
What is Teetotalism? Why is alcohol so fervently pushed upon society? Does alcohol prevent the body's absorption of Vitamin C?
Date: May 12, 2016 Source: American Physiological Society (APS)
Summary: Chronic exposure to alcohol interferes with the pancreas’ ability to absorb vitamin C, po- tentially predisposing the body to pancreatitis and other pancreatic diseases, a new study reports. The findings provide a link between chronic alcohol use and poor pancre- atic health.
Does it damage the blood-brain barrier making the brain susceptible to parasitic infection? pubmed.ncbi.nim.nih.gov/33799986/
Alcohol-Induced Blood-Brain Barrier Impairment: An In Vitro Study
Donatello Carrino 1, Jacopo Junio Valerio Branca 1, Matteo Becatti 2, Ferdinando Paternostro ! Gabriele Morucci 3, Massimo Gulisano 1, Lorenzo Di Cesare Mannelli ^, Alessandra Pacini !
Affiliations + expand PMID: 33799986 PMCID: PMC7967408 DOI: 10.3390/ijerph18052683 Free PMC article
Abstract
In recent years, alcohol abuse has dramatically grown with deleterious consequence for people's health and, in turn, for health care costs. it has been demonstrated, in humans and animals, that alcohol intoxication induces neuroinflammation and neurodegeneration thus leading to brain impairments. Furthermore, it has been shown that (BBB), but the molecular mechanisms underlining this detrimental effect have not been fully elucidated. For this reason, in this study we investigated the effects of alcohol exposure on a rat
If a mammal is unable to produce its own Vitamin C, and if that mammal is given a substance which prevents the body's absorption of Vitamin C, will that mammal suffer from a dramatically compromised immune system?
Would parasites thrive in such a host?
What is the [real] purpose for promoting alcohol consumption?
It gets worse.
Is the sugar industry highly subsidized? Do parasites require a continually high diet of sugar? More specifically: do parasites rely on aerobic glycolysis?
G @ ncbi.nlm.nih.gov/pmc/articles/PMC3989997/
TRENDS IN PARASITOLOGY ELSEVIER |
$ REE Full-Text Article 7
Trends Parasitol. 2014 Apr; 30(4): 170-175. PMCID: PMC3989997 doi: 10.1016/j.pt.2014.02.001 PMID: 24636355
1,2
J. Enrique Salcedo-Sora,1:* Eva Caamano-Gutierrez, Stephen A. Ward, and Giancarlo А. Biagini'
> Author information + Copyright and License information Disclaimer This article has been cited by other articles in PMC.
Abstract Go to: Ў
We hypothesise that intraerythrocytic malaria parasite metabolism is not merely fulfilling the need for ATP generation, but is evolved to support rapid proliferation, similar to that seen in other rapidly proliferating cells such as cancer cells. Deregulated glycolytic activity coupled with impaired mitochondrial metabolism is a metabolic strategy to generate glycolytic intermediates essential for rapid biomass generation for schizogony. Further, we discuss the possibility that Plasmodium metabolism is not only a functional consequence of the ‘hard-wired’ genome and argue that metabolism may also have a causal role in triggering the cascade of events that leads to developmental stage transitions. This hypothesis offers a framework to rationalise the observations of 20/5 2/49/27 atypical mitochondrial metabolism, and metabolic switching in nonproliferating stages.
Are parasites incapable of surviving on fats? Did the sugar industry pay to trick us into thinking that fat was the cause of ill health? LINK
Did this deceptive tactic dramatically reduce fat consumption while also increasing sugar consumption?
If fats protect against parasites and sugars promote them, what effect would removing fats and adding sugars have on the parasites infecting human hosts?
What is the [real] purpose of sugar subsidies?
It gets worse.
Is promiscuity shamelessly pushed upon society?
СЕ)
How I Told Му Husband and Boyfriend I'm Dating Another Man
1 already had a husband, a boyfriend, and all the guys I could fuck. ! had enough guys. Then there was Conor.
MORE VICE
Isn't Actually’ That Bad
Top Gaining Categories
аќ
Cuckold 472: Japanese 46 Indian 457 Cosplay 444 Korean 459
Transgender Creampie Gangbang French Cartoon
Taught One Man
The Couple | Open Relationships | мелік
| xo Be. e
Ip m
Can parasites be sexually transmitted? LINK1 LINK2
ISN'T ACTUALLY THAT BAD
DAILY BEAST
со Ga...
[The case for being a cuck.
Cuckolding: The Sex Fetish for Intellectuals
Why Being Called a Cuck Is Actually a Compliment
You should sleep with at LEAST 25 guys before settling down, and I'll tell you exactly why
Cuckold tattoos are the latest trend for the modern man
@ 006-00:
Why and How I've Cheated On Every Person I've Ever Dated
Why I Can't Stop Cheating
ө The New York Times ©
Opinion: Western men’s sperm counts are falling, and we ought
to be concerned. The Middle East
can help.
ia 00000
Micro-cheating on my partner was the best thing ever
How to Keep à Backup SO in Case You Get Dumped
=
Here Is Why A Husband Gives His Wife Encouragement To Be An Adulteress % ap
g Ove 567
#Cuckolding is a favorite among relationships.
e vice
He gets so much enjoyment кот my body - my boobs sre huge— but he cant perform the same way as someone with,
| INST: We Asked Couples Why They Opened Up Their Relationship
Man Says Letting His Wife Sleep Around Helped Him. ‘Get’ Feminism
Polyamorous Woman Says The Key To A Successful
The New Yorker @
o=
f adulterer
Marriage Is Having Multiple Partners
Woman goes on dates with
мала and both na put done work?
Yes, being against cuckoldin is low-key kinda racist
INSIDE THE WORLD OF CUCKOLDING: A
Se
CUCKOLD EXPLAINS ALL
а= Mail Online
"It's engrossingly erotic’: Research shows the number of men who want to see their partner have sex with others doubles in a decade
Can an open marriage EVER work? After 10 years and two children, one woman reveals what happened when she told her husband she wanted to sleep with other men
FEZIZEN Gs
A photographer who took pictures with people she met on Tinder and pretended to love revealed a lot about true intimacy
WATCHING YOUR PARTNER HAVE
CAN BE GOOD
marie daire SUBSCRIBE FAR-LEFT VOTERS MORE LIKELY TO SHARE WINGERS MORE
THEIR WIVES, RIGHT I Cheated on My Boyfriend pea ТУ with My Rapist By seducing my assaulter, | was reclaiming the control I'd lost over my body and identity.
[5
3
re Nous sommes |
PRÊTS!
I've cheated on every guy I've ever dated, and | don't feel even a little bit sorry
Ш pubmed.ncbi.nlm.nih.gov/29211102/
Adriano Rios ', Marcelle Ribeiro !, Alessandro Sousa !, Fernando Pimentel ', Luciana Hagström ', Rafael Andrade 1, Rozeneide М Alves 1, Ana de Cassia Rosa !, Antônio RI Teixeira 1, Nadjar Nitz 1 Mariana M Hecht !
Affiliations + expand PMID: 29211102 PMCID: PMC5719536 DOI: 10.1590/0074-02760170025 Free PMC article
Abstract
Background: Trypanosoma cruzi circulates in sylvatic habitats, mainly through blood-feeding triatomines, although other routes also contribute to its dispersion. Sexual transmission of T. cruzi is an understudied topic, especially among wild mammals. Because of the difficulties inherent to field work, experimentally infected mice are frequently used to evaluate the transmission of T. cruzi.
Objective: This study aimed to evaluate the sexual transmission of T. cruzi in acutely infected mice.
Methods: Male and female mice in the acute phase of Chagas disease were mated with naive partners. Then, parasitological tests, mmunohistochemistry, serological assays, and polymerase chain reaction (PCR) assays were used to detect infection.
Findings: Parasitological analysis showed trypomastigotes in the blood of 2096 of the naive mice after mating with infected partners. Serological assays detected anti-T. cruzi antibodies in all naive females mated with infected males and in 6096 of naive males mated with infected females. PCR showed T. cruzi nDNA bands for all naive mice mated with infected partners. The possibility of sexual transmission was also confirmed by visualisation of amastigotes in the testes.
Main conclusions: Our results demonstrate that ЭТЕ a ea tr E EE T HT s
that may contribute to maintenance of the parasite's enzootic cycle.
& ncbi.nlm.nih.gov/pmc/articles/PMC582
Evidence for Previously Unidentified Sexual Transmission of Protozoan Parasites Clara Crespillo-Andujar, ' Marta D az-Menéndez 2 and Marta Mora-Rillo
к Author information + Copyright and License information Disclaimer Abstract Goto: » Knowing the mode of transmission of a disease can affect its control and prevention. Here, we identify
5 protozoan parasites with demonstrated presence in seminal fluid, only 1 of which has been identified as a sexually transmitted disease among humans.
Spaghetti
How many different types of parasites exist?
Helminths, which are large organisms you can see with the naked eye. There are
Flatworms include flukes and tapeworms. Roundworms include pinworms, which are the most common helminth intestinal parasite in the United States.
Protozoa, which are one-celled, microscopic organisms. There are over 10,000 different protozoa species. In the United States, the most common ones include Giardia lamblia, Entamoeba histolytica, Cryptosporidium, and Cyclospora
cayetanensis.
If there are over 60,000 different parasites listed in just two categories, how many more must exist if all kinds of parasites are considered?
If all of these parasites can be transmitted between individuals through close, intimate contact, why are only 18 of them listed on medical sites as STDs?
Bacterial STDs
Syphilis
Chlamydia >) Chancroid
» Gonorrhea
Lymphogranuloma venereum Would increased sexual promiscuity result in an increase of infected hosts?
Non-gonococcal urethritis
Non-specific genital infection
Viral STDs Historically, what was the purpose of 'You may now kiss the bride’?
Hepatitis B ё betterhealth.vic.gov.au/health/conditionsandtreatments/kissing-and-your-health
HPV Viruses that can be transmitted by kissing
>) Genital warts
Examples of illnesses caused by viruses that can be transmitted during kissing include
Colds - also known as upper respiratory tract infections. Many different viruses can cause the common cold. Colds are thought to be spread by direct contact with the virus. You could catch the cold from airborne droplets or by direct contact with secretions (fluids and mucous) from the infected person’s nose and throat
Glandular fever — also known as the kissing disease. Glandular fever is the common term for a viral infection called infectious Ж mononucleosis, caused by the Epstein-Barr virus. The virus is spread through saliva and infection occurs through contact
ОБ анада Herpes infection — viruses that аге considered рагі of the herpes family include Epstein-Barr, varicella-zoster (causes chickenpox) and herpes simplex (causes cold sores). Herpes simplex virus can be spread through direct contact with the virus when kissing Herpes is most easily spread to others when the blisters are forming or have erupted. The virus can be ‘shed’ (spread to others) from the site of blisters even when they have healed. Chickenpox is easily spread from person to person by direct contact, droplets or airborne spread
Candidiasis (Moniliasis)
Parasitic
Hepatitis B — kissing may also transmit this virus, although blood has higher levels of this virus than saliva. Infection can occur when infected blood and saliva come into direct contact with someone else’s bloodstream or mucous membranes. (Mucous membranes line various body cavities including the mouth and nose.) A person is more likely to be infected when kissing if they have open sores in or around the mouth
ulosis pubic
Pedic
» Trichomoniasis
It gets worse.
10
Is plastic rare or everywhere?
Is it now found on top of mountains? Does it blanket the Artic?
Does it accumulate inside of our bodies?
Microplastics in the Arctic and the Alps may have blown in on the wind
09000000
ENVIRONMENT
14 August 2019
By New Scientist and Press Association
Do parasites associate well with plastic?
@ nature.com/articles, 22-10485-5 Апісіе | Open Access | Published: 26 April 2022
Association of zoonotic protozoan parasites with microplastics in seawater and implications for human
and wildlife health
Emma Zhang, Minji Kim, Lezlie Rueda, Chelsea Rochman, Elizabeth VanWormer, James Moore & Karen
Shapiro)
Scientific Reports 12, Article number: 6532 (2022) | Cite this article
5247 Accesses | 1 Citations | 965 Altmetric | Metrics
Abstract
Plastics are widely recognized as a pervasive marine pollutant. Microplastics have been
garnering increasing attention due to reports documenting their ingestion by animals,
including those intended for human consumption. Their accumulation in the marine food
chain may also pose a threat to wildlife that consume species that can accumulate
қ 5 2 В " "NP 1 Micropiastics found in the Alps are carried on the wind and brought to the ground with snow microplastic particles. Microplastic contamination in marine ecosystems has thus raised Werner L h/Gcet
concerns for both human and wildlife health. Our study addresses an unexplored area of
Tiny particles of plastic have been found in h parts of Germany and the Arctic, even places as remote as the island of Svalbard and in snow on drifting ice floes. These microplastics may have drifted there on wind currents.
igh concentrations in snow samples from the Swiss Alps, research targeting the interaction between plastic and pathogen pollution of coastal waters.
We investigated the association of the zoonotic protozoan parasites Toxoplasma gondii,
Cryptosporidium parvum, and Giardia enterica with polyethylene microbeads and polyester
microfibers. These pathogens were chosen because they have been recognized by the World га! a pnas.or о
Health Organization as underestimated causes of illness from shellfish consumption, and due
to their persistence in the marine environment. We show that 719199 еее in contaminated seawater, with more parasites adhering to
microfiber surfaces as compared with microbeads. Given the global presence of microplastics
© Janice Brahney, © Natalie Mahowald, (9 Marje ...
rs m in fish and shellfish, this study demonstrates a novel pathway by which anthropogenic See all authors and affiliations
pollutants may be mediating pathogen transmission in the marine environment, with
PNAS April 20, 2021 118 (16) e2020719118; https://doi.org/10.1073/pnas.2020719118
important ramifications for wildlife and human health.
Edge) environmental Health Perspectives Q
Edited by Akkihebbal R. Ravishankara, Colorado State University, Fort Collins, CO, and approved February 16, 2021 (received for review October 8, 2020)
Info & Metrics D PDF
—————-————-———-g--—--—
Microplastics on Human Kidney Proximal Tubular Epithelial Cells HK-2 and Male C57BL/6 Mice
Yung-Li Wang, Yu-Hsuan Lee, Yung-Ho Hsu,
United States of plastic It's raining plastic:
l-Jen Chiu, Cathy Chia-Yu Huang, Chih-Chia Huang, microscopic fibers fall Significa Zi-Chun Chia, Chung-Pei Lee, Yuh-Feng Lin, and 5 Мамет ены from the sky in Rocky Microplastic particles and fibers generated
Mountains
Published: 6 Мау 2021 CID: 057003 https://doi.org/10.1289/EHP7612
from the breakdown of mismanaged waste are now so prevalent that they cycle through
Discovery raises new questions about the amount of plastic waste permeating the air, water, and soil virtually everywhere on Earth
the earth in a manner akin to global
B About = Sections * PDF ВА <
biogeochemical cyclesgin modeling the
Abstract show that most atmospheric plastics are Background: Understanding the epidemic of derived from the legacy production of plastics
chronic kidney disease of uncertain etiology may be from waste that has continued to build up in critical for health policies and public health А . responses. Recent studies have shown that the environment. Roads dominated the
micropl св (MPs) contaminate our food chain and p = sources of microplastics to the western accumulate in the gut, liver, kidney, muscle, and so
on. Humans manufacture many plastics-related : A United States, followed by marine, agriculture,
рго ts. Previous studies have indicated that 2 particles of these products have several effectson | «< It gets worse.
11
and dust emissions generated downwind of
Why is our drinking water fluoridated? Does fluoride damage the immune system? What is fluorosis?
Would this increase parasite infection?
& ncbi.nlm.nih.gov/pmc/articles/PMC2956113/
It has been described that application of sodium fluoride (NaF) as the main fluoride source to cells under culture can induce an excess of p53, a protein expressed when there is damage to the DNA [7]. On the other hand, induction of apoptosis has been described in the epithelial cells of human lung cultured with
experimentation can cause liver damage expressed as induction in the expression of caspases (that are the last effectors of apoptosis), as well as of the protein bcl-2 (the protein activated during apoptosis) [10,11].
Conversely, it has been reported that in geographic zones where fluorosis 1s endemic, there 1s an increase in the presence of bacterial, viral, and Parasitic infections in humans or in wild or farm animals that have been intoxicated with this type of compound when it is present in drinking water in concentrations exceeding the maximal dose recommended by the World Health Organization (WHO), which is <1 parts per million (ppm) of NaF [1.2]. In Mexico, acute and chronic fluorosis is present mainly in central-northern states in which the water presents NaF concentrations that exceed WHO health norms [1]. The presence of NaF in aquifers is very important because this compound 1s not filtered by the conventional water purification systems that are employed precisely to prepare water for human consumption [1—6]. Also, NaF dissolved in water has neither taste nor smell: thus, people can ingest great quantities of this toxin without being aware of it [1,6]. Once consumed, NaF can cause alterations in systems such as digestive, nervous, reproductive, and immunological [1.12].
As mentioned previously, individuals who present fluorosis are more susceptible to presenting bacterial, viral, and parasitic infections, which indicates that there can be a change in their immune system, in which leukocytes play a very important role as defense systems against these infections [1]. From another viewpoint, it is known that a in p blood circulation à have completed Тқ =< life
have demonstrated that leukocytes incubated in the presence of NaF | present an increase in the expression of proteins p53 and bcl-2, which are considered markers of the presence of apoptosis [1,4-8] and which would indicate that this toxin can promote this type of phenomena in systems іл vivo.
... presence of NaF in aquifers is very important because this compound is not filtered by the conventional water purification systems that are employed to prepare water for human consumption
.. for human consumption
Flavor»
f e, ..human consumption 4,7. ride (is i
Fluorosis >>> Immunocompromised >>> Hosts more susceptible to parasites
Why do they [really] fluoridate our drinking water?
It gets worse.
12
Why is there such a large push for bug protein and cockroach milk?
[Lvetve|] =
=} MARKETS BUSINESS INVESTING TECH POLITICS CNBC TV INVESTING CLUB @ PRI
Drink up: Cockroach milk is the protein drink you didn't know you've been missing
By Susan Sculti, CNN
FOOD & BEVERAGE
Updated 10:22 AM EDT, Wed July 27, 2016
Will eating edible insects spread parasites?
Q
@ pubmed.ncbi.nim.nih.gov/33108441/
Edible Insects and Toxoplasma gondii: Is It Something We Need To Be Concerned About?
Maurizio Percipalle 1 2, Antonio Salvaggio 13 Giovanni M Pitari ê, Renato P Giunta 1 5,
1
Alessandra Араго 1, Tiziana Alfonzetti 1, Anna Maria Fausta Marino ! 6
Affiliations + expand PMID: 33108441 DOI: 10.4315/JFP-20-239
Abstract
Abstract: Novel foods, such as edible insects and food products on the basis of insects, could play an important role in both human and animal nutrition in the future. The identification of dangers associated with insect consumption is fundamental to guarantee consumer safety and adequate regulatory guidelines for operators of the food sector. Although former studies have focused on the microbiological contamination of fresh or processed edible insects, so far little information is available about the occurrence of foodborne parasites, such as Toxoplasma gondii, whose life cycles make them candidates for potential insect breeding substrate contamination. Hence, we investigated the presence of contaminating T. gondii in farmed edible insects to rule out this further hazard for
consumers. Four species of insects most commonly used as food for human consumption were analyzed: mealworm; African migratory locust, house cricket, and silkworm. Samples included live specimens but also minimally (dehydrated) and highly processed edible insects. рМА ууеге детестеді іп ватріе5 оҒ 4деһуагағейі теаімогпт These results highlight the need for implementing good farming and processing practices with particular care paid to safe storage and handling of feed and substrates used for edible insects to reduce the chance of T. gondii entering the human food chain.
Пп ё pubmed.ncbi.nim.nih.gov/31283777/
A parasitological evaluation of edible insects and their role in the transmission of parasitic diseases to humans and animals
their parts. One of the most commonly used species of insects are: mealworms (Tenebrio molitor), house crickets (Acheta domesticus), cockroaches (Blattodea) and migratory locusts (Locusta migrans).
What is the [real] reason why they want to use insects as a food source?
In this context, the unfathomable issue is the role of edible insects in transmitting parasitic diseases
that can cause significant losses in their breeding and may pose a threat to humans and animals. The
aim of this study was to identify and evaluate the developmental forms of parasites colonizing edible
insects in household farms and pet stores in Central Europe and to determine the potential risk of
parasitic infections for humans and animals. The experimental material comprised samples of live
insects (imagines) from 300 household farms and pet stores, including 75 mealworm farms, 75 house
cricket farms, 75 Madagascar hissing cockroach farms and 75 migrating locust farms. Parasites were detected in 244 (81.33%) out of 300 (100%) examined insect farms. In 206 (68.67%) of the cases, the identified parasites were pathogenic for insects only; in 106 (35.33%) cases, parasites were potentially
parasitic for animals; апа іп 91 (30.3326) Cases, parasites were potentially pathogenic for humans§
13
It gets worse.
What is the purpose of vaccines? Are excipients, such as polysorbate-80 placed into vaccines?
& sciencedirect.com/science/article/pii/0378517389902664
International Journal of Pharmaceutics Volume 57, Issue 1, 15 December 1989, Pages 77-83
The effect of polysorbate 80 on brain uptake and analgesic effect of D-kyotorphin
Toshiyasu Sakane *, Chihiro Tanaka :, Akira Yamamoto +, Mitsuru Hashida >, Hitoshi Sezaki 2,1, Hiroshi Ueda 2, Hiroshi Takagi?
Show more v
https://doi.org/10.1016/0378-5173(89)90266-4 Get rights and content
Abstract
The effect of the non-ionic surfactant, polysorbate 80, on the blood-brain barrier was investigated by using an in situ brain perfusion technique. It was confirmed that the brain perfusion technique allowed quantitative measurement of the cerebrovascular transport of drugs with varying degrees of lipophilicity and D- glucose. A linear relation was obtained between cerebrovascular PA products of drugs and their octanol/water partition coefficients. Transport of D-glucose, which is known to be a carrier-mediated process, was observed to be concentration- dependent and the Ky, Vmax and Қа values could be obtained by non-lineara least- squares regression. It was shown in perfusion experiments that the intravascular volume calculated from [**C]inulin was increased significantly by intravenous administration of polysorbate 80. The content of D-kyotorphin also showed a tendency to increase. These effects of polysorbate 80 were also confirmed by the analgesic effect of D-kyotorphin in mice in vivo. D-Kyotorphin at 300 mg/kg showed no analgesic activity whereas it did display a significant level following administration with polysorbate 80. These results suggested that polysorbate 80
@ nature.com/articles/srep31578 affected the blood-brain barrier and enhanced the brain uptake and analgesic
activity of D-kyotorphin. Abstract
adjuvants remain the most widely used and effective
adjuvants in vaccination and immunotherapy. Herein, the particle size
Are adjuvants, such as aluminum, placed into vaccines?
distribution (PSD) of aluminium oxyhydroxide and aluminium
hydroxyphosphate adjuvants was elucidated in attempt to correlate
these properties with the biological responses observed post
By temporarily distracting the immune system with the vaccination. Heightened solubility and potentially the generation of Al* adjuvant, is the immune system less capable of reacting to other threats?
What is reactogenicity?
Could this cause a rapid increase in parasitic infection?
in the lysosomal environment were positively correlated with an
increase in cell mortality in vitro, potentially generating a greater
inflammatory response at the site of simulated injection. The cellular
uptake of aluminium based adjuvants (ABAs) used in clinically approved
vaccinations are compared to a commonly used experimental ABA, in an
in vitro THP-1 cell model. Using lumogallion as a direct-fluorescent
molecular probe for aluminium, complemented with transmission
Do these excipients and adjuvants help intra-bodily ob- jects cross the blood-brain barrier?
electron microscopy provides further insight into the morphology of
internalised particulates, driven by the physicochemical variations of
the ABAs investigated. We demonstrate that not all aluminium adjuvants
are equal neither in terms of their physical properties nor their
Are parasites intra-bodily objects?
biological reactivity and potential toxicities both at the injection site
and beyond. High loading of aluminium oxyhydroxide in the cytoplasm
of THP-1 cells without immediate cytotoxicity might predispose this
form of aluminium adjuvant to its subsequent transport throughout the
body including access to the brain.
Are adjuvants and excipients placed into vaccines to help parasites gain access to human brains?
14
Are parasites an infectious disease? Diseases Declined 90%
To prevent disease, should we focus on more BEFORE Vaccines Were introduced injections or on access to clean water? Mane * i Due to Sanitation and Clean Water Systems
Whooping Cough / Pertussis Diphtheria
3 А А Vaccine Historically, which was more successful?
Death Rate
88885884858
Measles Scarlet Fever
Death Rate 882888588
8882883858 © Kolten Parker © Mi GkolenParker [ v Fonon | Typhoid Fever Black water coming out of taps in Crystal City as 5 city officials
are under fed indictment mysanantonio.com/news/local/art... 1:27 PM - 19 Feb 2016
- [3
No widespread Vaccine
vaccination
Death Rate Death Rate "usus
о „5
@ theguardian.com/environment/2016/jan/16/flints-water-crisis-what-went-wrong
Flint's water crisis: what went wrong
If clean water is so effective at preventing disease, then reconcile the following:
After the water supply was found to contain high levels of lead, evidence is mounting that officials ignored or neglected indicators 1. Amount of money spent on water ofa growing crisis
treatment facilities 2. Amount of money spent on develop- ing patentable vaccines
What is the [real] purpose of vaccines?
It gets worse.
What are heavy metals? Do parasites associate well with heavy metals?
Is aluminum a heavy metal?
Is aluminum sprayed over major metropolitan areas to "prevent global warming by reflecting sunlight"?
Is cadmium a heavy metal?
Did the US government admit to spraying ZnCdS over 29 urban and rural areas in the US and Canada? LINK
Do these heavy metal particles eventually fall to earth where they enter the body through respiration?
What other ways might heavy metals, like aluminum, enter the body? Is there a way for heavy metals to bypass the body's natural filtration system?
Aluminum in vaccines
Aluminum is used in vaccines as an adjuvant. An adjuvant is vaccine component that boosts the immune response to the vaccine. Adjuvants allow for lesser quantities of the vaccine and
fewer doses. The adjuvant effects of aluminum were discovered in 1926. Aluminum
vaccines, Haemophilus influenzae type b, and pneumococcal vaccines, but they are not used
in the live, viral vaccines, such as measles, mumps, rubella, varicella and rotavirus.
Previous studies have linked frequent exposure to high levels of aluminum to adverse health effects on the central or peripheral nervous system or both), Alzheimer's disease, and breast cancer. Jan 15, 2020
www.medicalnewstoday.com » articles
How can we reduce our exposure to potentially harmful ... Eye Worm
Nose Worm
е с @ cell.com/parasitology/comments/S0169-4758(98)01358-1 Are dormant parasites activated
by the presence of heavy metals? о Trends in Parasitology
REVIEWS ME 15, ISSUE 1, P16 ANUAR Parasites as Accumulation Indicators of Heavy Metal Pollution
В. Sures • К. Siddall « H. Taraschewski e B. Sures R. Siddall > H. Taraschewski
DOI: https-//doi.org/10.1016/50169-4758(98)01358-1
~ PlumX Metrics
What is the [real] reason for Abstract putting heavy metals into our
ў Parasites are attracting increasing interest from parasite ecologists as potential bodies?
indicators of environmental quality because of the variety of ways in which they respond to anthropogenic pollution. However, until recently, little was known about the accumulation of toxins within parasites. Certain parasites, particularly intestinal acanthocephalans and cestodes of fish, can accumulate heavy metals at concentrations that are orders of magnitude higher than those in the host tissues or the environment. In this review, Bernd Sures, Roy Siddall and Horst Taraschewski discuss the recently
It gets worse. described phenomenon of conspicuous metal accumulation by parasites and how this might be applied to environmental monitoring. They also suggest how environmental science and parasitology might profit from each other in the near future.
In contrast, does Fenbendazole eliminate parasites without side-effects? 15 Fenbendazole successful in removing parasites from any mammal? Can it even successfully remove parasites from non-mammals, such as reptiles and fish?
ШЕ ecommons.luc.edu/cgi/viewcontent.cgi?article=4366&context=luc_theses
1985
Survey of Intestinal Parasites in Zoo Populations of Two Central Illinois Zoos and Study of Current Anti-Parasitic Drugs and Prophylactic Techniques
Verona A. Barr Loyola University Chicago
and Lawrence (1982) used fenbendazole in the treatment of 82 reptiles. They found fenbendazole to be effective against single and mixed infections of ascarids, oxyurids and strongyloides in 84.1% of the reptiles treated. А11 of the snakes were given a single dose while the tortoises were given two doses separated by a three week interval. No deaths or side effects were observed in the test group. In general, the literature has shown that fenbendazole is
apparently free of side effects.
H N NHCOOCH,
All without side effects.
15 Fenbendazole safe for use in humans? LINK
EUROPEAN MEDICINES AGENCY
SCIENCE MEDICINES HEALTH
15 January 2014 EMA/42178/2014 Veterinary Medicines Division
CVMP assessment report for Panacur AquaSol (EMEA/V/C/002008/X/0003)
International non-proprietary name: fenbendazole
Assessment report as adopted by the CVMP with all information of a commercially confidential nature deleted.
Toxicological studies
Single dose toxicity
Oral single dose studies in mice, rats, rabbits and dogs demonstrate that fenbendazole is of low acute toxicity. The study results did not allow the derivation of no-observed-adverse-effect levels (NOAELs).
Repeat dose toxicity
Data on repeat dose toxicity are available from rats and dogs. The overall NOAEL was 4 mg/kg bw/day, based on lymphoid hyperplasia observed in dogs.
Tolerance in the target species of animal
Please refer to Part 4. No points of concern relevant for the safety of fenbendazole in humans could be identified.
18
If Fenbendazole has no side effects and is safe for human consumption, why was an extensive study funded to determine how long ‘animals used for human consumption’ must be weaned off of Fenbendazole in order to ensure the removal of Fenbendazole from the animal before slaughter?
EUROPEAN MEDICINES AGENCY
SCIENCE MEDICINES HEALTH
15 January 2014 EMA/42178/2014 Veterinary Medicines Division
CVMP assessment report for Panacur AquaSol (EMEA/V/C/002008/X/0003)
International non-proprietary name: fenbendazole
Assessment report as adopted by the CVMP with all information of a commercially confidential nature deleted.
Withdrawal periods
Based on the provided residue depletion study in tissues a Withdrawal period of 6 days for edible)
tissues can be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for chicken when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for 5 consecutive days.
The withdrawal period for slaughter is calculated using the alternative approach by taking the first time point where all concentrations are below the respective MRL (72 hours for liver, 96 hours for muscle and 120 hours for kidney and skin+fat) and adding a safety span of 20%, resulting in a withdrawal period of 4 days for liver, 5 days for muscle and 6 days for kidney and skin+fat. Overall withdrawal period for slaughter: 6 days.
Based on the provided residue depletion study in eggs a withdrawal period of zero days for eggs can be established for Panacur AquaSol 200 mg/ml oral suspension for use in drinking water for chicken when administered at the maximum recommended dose of 1 mg fenbendazole/kg bw/day for 5 consecutive days.
As at all-time points residue levels were below MRL (though above LOQ), the withdrawal period is calculated by estimating the 95% tolerance limit for each time point (safe concentration per milking (SCPM) method for milk). The 9596 tolerance limits for all time points were below MRL. Withdrawal period for eggs: zero days.
19
Compare this treatment of Fenbendazole to the treatment of Glyphosate.
Does Glyphosate cause terrible damage to the cells inside the human digestive tract?
Does this ‘damaged human digestive tract’ result in the digestive tract inefficiently absorbing vitamins and minerals required for a strong immune system?
Is Glyphosate sprayed directly onto crops used for human consumption? Is Glyphosate sprayed onto crops immediately before harvest, resulting in Glyphosate absorbing into food meant for human consumption?
Would spraying Glyphosate onto ‘food meant for human consumption’ compromise the immune system of any human who ate that food?
Does compromising the human immune system benefit parasites inside human hosts? LINK
Compare and contrast:
Fenbendazole harms parasites inside humans.
Glyphosate helps parasites inside humans.
Fenbendazole is illegal in food meant for human consumption. Glyphosate is legally authorized in food meant for human consumption.
Reconcile.
It gets worse.
20
If Fenbendazole has no side effects and is safe for human consumption, why is Fenbendazole labeled ‘not for human consumption’?
If Fenbendazole has no side effects and is safe for human consumption, why require that
Fenbendazole not be used in animals meant for human consumption?
“For other areas in the world, retreatment periods for the migrating larvae of S. vulgaris may be different; consult with your veterinarian.
CAUTIONS: Keep this and all medication out of the reach of children.
DOSAGE:
Panacur® (fenbendazole) Paste 10% is administered orally at a rate of 2.3 mg/Ib (5 mg/kg) for the control of large strongyles, small strongyles, and pinworms. One syringe will deworm a 1,100 Ib horse. For foals and weanlings (less than 18 months of age) where ascarids are a common problem, the recommended dose is 4.6 mg/b (10 mg/kg); one syringe will deworm a
550 Ib horse.
Let us review:
Fact: Despite there existing a recommended parasite schedule for every other species which comes into direct contact with humans, there exists no recommended parasite treatment schedules for humans.
Fact: It has been made illegal to treat humans with the most effective methods for treating parasites.
Fact: All parasite medications are intentionally prevented from entering food meant for human consumption.
All of this results in a system where humans are forced to rely entirely upon their immune system to combat parasites. However...
Fact: Humans have a naturally weak immune system due to their inability to produce Vitamin C.
Fact: The human immune system has been intentionally weakened through a variety of external methods: 1. Fluoride added to our water 2. Heavy Metals added to our air 3. Glyphosate added to our food 4. Adjuvants added to our vaccines 5. Alcohol pushed in mainstream media 6. Microplastics added to environment
Fact: The spread of parasites is intentionally encouraged in variety of ways: 1. Sugars added to our food 2. Infected insects used as food 3. Addictive psychiatric drugs prescribed by doctors 4. Promiscuity pushed in mainstream media 5. Fenbendazole removed from our food
X9,000 — 2um
Healthy Immune Function
Taken together, these things turn the human body into the perfect parasite-breeding ground. Due to lifestyle choices, environmental factors and genetic factors, humans are systemically much more susceptible to parasitic infection than any other mammal.
So why do all other mammals have recommended parasite-treatment schedules and humans do not?
Logical thinking.
The answer is worse than you can imagine. 21
2. THE BRAIN
Why do parasites need access to human brains?
@ INDEPENDENT
SPORT
Can the parasite gain control over the host by accessing the central nervous
system? "Lombie' deer disease could spread to humans, experts warn
NEWS POUTICS VOICES CULTURE INOY UFE INDYBEST voto DAILY EDITION
‘It’s possible the number of human cases will be substantial and will not be isolated events’
@JournoJane | Monday 18 February
Can parasites lobotomize their host and turn them into living zombies?
People who eat deer meat could be at risk of contracting a deadly
infectious disease that is spreading across the animals’ US populations,
experts have warned.
LINK
Chronic wasting disease (CWD) -dubbed “zombie” deer disease - has infected deer. elk and moose across 24 American states and two Canadian
provinces.
The disease attacks tissues including the brain} and spinal cord, causing dramatic weight loss, loss of coordination, listlessness, drooling, excessive
@ sciencedaily.com/releases/2019
Science News thirst or urination and intense aggression before the animal dies.
‘Flying salt shakers of death:' Fungal-infected 'zombie' cicadas
June 25, 2019
West Virginia University
West Virginia University researchers have discovered that a cicada fungus called Massopora contains chemicals similar to those
found in hallucinogenic mushrooms = : ex THA "m
9 Meet Sacculina carcini - а barnacle that makes a living as a real-life body-snatcher The fungus causes cicadas to lose their limbs and eccentric be- of crabs. Unlike most barnacles that are happy to simply stick themselves to a rock havior sets in: Males try to mate with everything they encounter. al- and filter food from the water, Sacculina and its kin have evolved to be parasitic,
and they are horrifyingly good at it.
Despite the horrid physical state of infected cicadas, they continue The microscopic larva of Sacculina seeks out an unsuspecting crab using to roam around freely as if nothing's wrong, dousing other cicadas
with a dose of their disease
specialised sensory organs. It then settles on a part of the crab where its armours is most vulnerable, usually on the membrane at the base of one of the crab’s hair
А (called a setae). You've heard of "The Walking Dead." This is "The Flying Dead."
"They are only zombies in the sense that ШЕПТЕ Кеете Eod
said Matt Kasson, assistant professor of forest pathology and one of the study's authors
The larvae then transforms itself into a kind of living hypodermic syringe (called a kentrogon). This syringe stabs the base of the crab's hair and injects the next stage of the parasite - a microscopic blob called the vermigon - into the crab's
bloodstream. This blob will eventually grow into a parasite та 1107591175
rab's entire body. Why lobotomize the host? Sacculina (аке оует (һе һові іп Бойһ Боду апа тіпа it castrates the crab, then
turns it into a doting babysitter that grooms and aerates the barnacle’s brood, tending the next generation of baby-snatchers as if they were its own babies. Lest
Does the lobotomy allow pa rasites to force you think Sacculina is alone in its nightmarish ways, it is just one genus in an the host to spread the infection to new entire order of barnacles called Rhizocephala (the “root head”). hosts?
In estuaries around the world, tiny trematode worms take over the bodies of aquatic snails. These parasitic flatworms invade the
22
What happens when parasites enter the brain of a human host? Can the brain be damaged to influence human behavior?
Can the brain be damaged to limit human cognitive abilities? What are NPCs?
NPC
Do humans have a second brain?
What is the Enteric nervous system? LINK
Where are parasites most commonly found?
Can parasites residing in the gut influence behavior? What are ‘Gut Instincts’?
What is the subconscious?
Can the subconscious be manipulated?
Can parasites manipulate the subconscious to change human personality?
@ newscientist.com/gallery/mg20327161300-enemy-within-human-parasites
mper NewScientist
News Podcasts Video Technology Space Physics Health More » Shop Tours Events Jo
The enemy within: 10 human parasites Why influence host personality? 60000 Why influence host behavior?
9 July 2009
Symbiotic relationships between a parasite and a host can have beneficial еНесе even changing | тт енна and evolution. Often, however, the damage outweighs the positives. New Scientist investigates some of the most common human parasites and the damaging effects they can have
The end goal of a parasite is not to kill the host, but to spread more parasites to more hosts.
It gets worse.
Reminder: Are parasites sexually transmitted? Reminder: Can parasites change the host’s personality? Why might the following behavior seem so prevalent?
H] | know the type all too well.
It's like meeting Agent Smith. They are all the same personality. Sick and twisted but in exactly the same way. Dumb as all shit too. Unable to create anything new. They have no original thoughts.
2118 ! Г How many people did you sleep with in college?
40 comments share save hide report crosspost
j by: best w
RainbowCrocs
Let's see. 3 a week. 50 weeks in a year. 200 weeks in 4 years. So around 600.
permalink embed save give award
NU
2 UnnamedNamesake
Never kept count. But over 200.
permalink embed save give award
9 kimininegaiwo
I would never tell my boyfriend this, but more than 100. А А А
болтын ombud өне чаны The infected engage іп promiscuous ons behavior to spread the parasite.
I wrote down all their names in a spreadsheet. And the magic number is.....ding, ding, ding...
permalink embed save give award
of Venne1139 ' The infected create a promiscuous I was the Pi Kappa Alpha Dream Girl so a lot of frat guys. Probably around 100. society to spread the pa rasite
permalink embed save give award
tessanicoleS 50 FIV. If you include giving oral then more than 400,
permalink embed save give award
Hollywood told us we would fight man-eating zombies during the apocalypse.
But it is something much more subtle, much more alluring, and far, far more frightening:
They are sex zombies.
24
Why does every major civilization collapse when it allows promiscuity? Do parasites use sexual promiscuity to turn citizens into zombies? Do the infected sex zombies then tear down their own civilization?
If you want to destroy any nation without war, make adultery or nudity
British ethnologist and social anthropologist at Oxford Mai and Cambridge University, Joseph Daniel
Unwin MC (1895 - 1936) conducted a massive study of 6 major civilizations and 80 lesser societies covering 5.000 years of history. He set out his study expecting to find evidence supporting Sigmund Freud's theory that civilizations are essentially neurotic and coe themselves by restricting sex too much. But to Unwin's surprise, a the evidence he discovered pointed exactly to opposite conclusions.
Saladin чү
- жі
In his exhaustive examination of sexual behavior and their
affect upon society, Unwin observed that monogamous : ; А cultures prosper and those disinclined to restrain.sex to What is the Bacchanalian Conspiracy?
monogamous marriage remain primitive or, if once Did it lead to extreme Roman degeneracy?
successful, they decline. Did women rule over it? әлігі Unw in Wor Why did it involve violence and sodomy?
T and Culture Seanad Охо University Press, 1934); Why did homosexuality become the norm? Sexual Regulations and Cultural Behavior (London: Oxford University Press, 1935) A э
Hopousia: Or the Sexual and Economic Foundations of a New Society (London: Why did Rome [really] collapse: George Allen and Unwin, 1940).
“Under cover of religion, priests and acolytes broke civil, moral and religious laws with impunity. Young girls and youths were seduced, and all modesty was set aside. Every kind of vice found its full satisfaction. But crimes did not remain confined to these meetings. False witnesses, forgeries, false wills and denunciations proceeded from this focus of crime. Poisoning and assassination were carried on under the cover of the Bacchanalians.”
Does any of this sound familiar?
"Unwin's conclusions, which are based upon ап enormous wealth of carefully sifted evidence, тау be summed up as follows. All human societies are in one or another of six cultural conditions: zoistic, manistic, deistic, rationalistic, expansive, productive. Of these societies the zoistic displays the least amount of mental and social energy, the productive the most. Investigation shows that the societies exhibiting the least amount of energy are those where pre-nuptial continence is not imposed and where the opportunities for sexual indulgence after.
It gets worse. 25
Tami
А : ЕР Are you infected with parasites: July 15, 2016 at 9:30 PM
How would you know? Should you get tested?
Is testing even effective? LINK NK Thad 4 stool tests to date, one by the lab my Doctor ordered at the lab he uses and 3 from me going to emergency rooms. All tests with negative results. But my stool samples were full of parasites as they are every bowel movement and very visible. I have had them for no less than 5 years. I feel like I’m fighting for my life and the Doctors are letting me die by ignoring what is so obvious to see. I have taken in bottles of my stool watered down with living, moving parasites at the bottom of the bottle, certain that i could finally convince someone to do something to get rid of them before they kill me. I have recognized no less than 5 different parasites by breaking down my stool in water until I can see the parasites. jinga uo can see them and still will not prescribe medication
Бесаиѕе е 1а геѕиїёѕ соте Баск перануе There's something wrong with that picture,
Anonymous (ID: 6527270) = 08/26/22(Fri)23:17:45 No.392742108 » >>392742262
22392740841
The doctor likely had zero education on parasites. Life cycles, vectors etc.
22392741217
| unintentionally fasted when | got very sick with ? for 3 weeks and couldn't hold anything down. They migrated out of my alimentary system. | explained it up thread.
| went to a ENT. It got very ugly between us. She accused me of DL images from Internet. VERY expensive bullshittery. My breast cancer friend | spoke about was telling her neighbor about my nose worms. The neighbor thinks--hey maybe that's what's wrong with me. So buys one of those pump type neti pots. First go sucks out a mess of worms, Panics, rushes with container to doctor...who refused to send them to the lab, and gave her 1 pill.
Try getting a fecal float test from a doctor. One lady dropped a LIVE one on top of her 'sample" and the test results came back NOPE--you don't have parasites. She documented it all with pics. Including the live one on top of her "sample".
Dr. Klinghardt discusses parasite detection:
Unfortunately, there are no reliable lab tests to rule out parasites, especially those that stray from the gut into the central nervous system.
Insiders estimate the detection rate to be less than 196. So out of a hundred people who һауе parasites, [lab tests will show a positive result] in one.
Every parasitologist knows this, but they are not allowed to talk about it. As a clinician | have to say, there are way more people being made ill by parasites than the lab work can show right now. [3]
signs of parasites
Important Video: LINK
anxiety /
brain fog/ depression
weak memory
How ever, to have parasites, it c etc And boom, y
stomach : : infections problems Instead of looking for a root problem on diseases
adhd, and have to dea h the medicines side е Look for parasites in you, it might be the root problem to your depression, over eating, mental fogginess. Etc
| was raised in MX, so this is a commonly recommended tion on families
dark circles
under eyes иш
ssues
headache
They actually have a ton of commercials about it The Red Cross used to administer dewormers at the sc
problems
THEY KNOW--my mom told me that when they were growing up they were lined up in the garage once a month and treated with kerosene or turpentine (both are or were pure pine oils) then given a hefty dose of castor oil.
They were no more dirty etc than modern life is, in fact likely cleaner. They wouldn't allow dogs/cats in the house 7doggo goes out for morning shit, sniffs around yard, rolls in raccoon shit or sniffs, eats it >runs back in house jumps in bed with baby and licks it's face
Raccoons carry FLUKES, fluke eggs stick to fur, rover licks fur, your face, and sprinkles the parasite by products..everywhere
| watched on "van life couple" take their cat to the vet when it shat out parasites on their bed. | was like..what about you? What about baby? What about---nope--just the cat got treated.
Are you infected? Does your poo float? Do you have body odor?
Do you get headaches? Anonymous (ID: ERZI) L+] 04/06/22(Wed) 11:48:18 No.371469040 »
Do you have addictions? >>371455554
| was addicted to weed and coca cola, magically stopped being addicted after doing a deworming procedure similar to yours. And my shit stopped floating, would just sink to the bottom of the toilet.
>>371458800
I've been pretty clear minded since, just take probiotics ог eat something that will replenish the biome.
Q ё pubmed.ncbinlm.nih.gov/1730397 Not that hard.
> Am J Ther. 2007 Jan-Feb;14(1):63-105. doi: 10.1097/01.mjt.0000208 272.42379
Recurrent headache as the main symptom of acquired cerebral toxoplasmosis in nonhuman immunodeficiency virus-infected subjects with no lymphadenopathy: the parasite may be responsible for the neurogenic inflammation postulated as а cause of different types of headaches
Joseph Prandota !
Affiliations + expand PMID: 17303977 DOI: 10.1097/01.mjt.0000208272.42379.aa
Abstract
Headache and/or migraine, a common problem in pediatrics and internal medicine, affect about 5% to 10% children and adolescents, and nearly 30% of middle-aged women. ШЕСІ P P 03
most common clinical manifestations of acquired Toxoplasma gondii infectiong 4 ие
system (CNS) in immunosuppressed subjects.
Common Symptoms of Parasites in Humans
i Constipation. Gas or bloating. Diarrhea.
Pains or aches in the back, joints or muscles. Irritable bowel syndrome. Allergies.
Increased appetite.
Itchy ears, nose or anus. Nervousness or grumpiness. Chronic fatigue, lethargy or apathy. Various skin problems. Tooth grinding or clenching. Anemia.
Excess weight.
Forgetfulness. = Vision problems. zs Problems sleeping.
Do you have allergies? LINK
Do you has asthma? LINK
Do you have diabetes? LINK
Did you answer 'yes' to any of these questions?
27
Do you eat fruits or vegetables?
Do you eat meat?
Do you drink tap water?
Do you shower with tap water?
Have you ever used a public restroom?
Do you pick your nose?
Have you ever had a cold?
Have you had more than one sex-partner? Has your sex-partner been with anyone else? Are your pets allowed inside the house?
Your pets
Or do you have no symptoms at all?
"You can have a person riddled with infection who never realized there's a 2-centimeter-long worm in their eye and thousands of parasites in their blood,” Dillman said. "The immune system never signaled something was wrong. How is that possible? We know
very little about how that works.”
Dillman is focused specifically on the proteins that nematode spit releases into hosts during an
infection.
& naturalnursemomma @naturalnursemom
The CDC says that only 14% of the US population has been exposed to parasites. But that isn't anywhere near the reality of it. Conventional medicine all but ignores them because most tests do not pick them up.
Increasing food allergies, anxiety, insomnia are all linked to 2 ©.
Parasites are arguably the most common cause of health issues today. The amount of symptoms caused by them are endless as they impact structural, chemical, and emotional functions. This is a reason why they are ignored by medicine, most believe a digestive symptom must be present
However, on top of GI symptoms, parasites are linked to teeth grinding, insomnia, anxiety, depression, seizures, skin issues, allergies, fatigue, chronic pain, anemia, itchy butt, add/adhd, bed wetting and night terrors to name a few.
Science News from research organizations
Memory, Depression, Insomnia - - And Worms?
: August 5, 2008 Oklahoma Medical Research Foundation
Researchers have spent decades probing the causes of depression, schizophrenia and insomnia in humans. But a new study may have uncovered key insights into the origins of these and other conditions by examining a most unlikely research sub-
Associations of mental disorders and neurotropic parasitic diseases: a meta- analysis in developing and emerging countries
Labanté Outcha Daré ©, Pierre-Emile Bruand, ..Pierre-Marie Preux + Show authors
BMC Public Health 19, Article number: 1645 (2019) | Cite this article
1.Parasites contribute to fatigue by feeding on iron. They steal your iron stores causing clinical or subclinical anemia which equates to low oxygenation of your tissues. This manifests as fatigue.
2.Parasites contain many serotonin receptors. This means they also steal your serotonin which is the hormone that when low relates to anxiety/ depression & insomnia. This is also why symptoms near the full moon are often due to parasites because serotonin levels are increased.
3.Parasites also shift the immune system into a TH2 pattern which elevates IgE and mast cells in the body. This equates to allergies of all kinds including food and environmental. Skin issues like hives and rashes also result from this TH2 shift.
| The role of parasites and
pathogens in influencing generalised anxiety and predation-related fear in the mammalian central nervous system
Maya Kaushik et al. Horm Behav. 2012 Aug.
(Intestinal parasites and lactose malabsorption] [Article in French]
D Gendrel et al. Arch Fr Pediatr. 1990 Oct.
Show details x
Abstract
Breath-test was performed for diagnosis of lactose malabsorption in 50 Gabonese children of normal nutritional status, aged 5 to 15 years, with parasites in stools, but without diarrhoea or digestive symptoms. Control group was unparasitized and
28
naturalnursemomma Here's the thing about this issue... you go to your regular provider and they say okay let's run a stool test. It's called an ova and parasite (O&P) ... but it's negative every time. At the very least, they need to repeat x3. BUT testing for parasites is elusive... and what is worse? Testing for Lyme, mold can be elusive too.. these things like to hide in parasites. As well, with a chronic gut infection from parasites you will also have immune suppression increasing the likelihood of constant sickness.
Symptoms of parasites might look like the things mentioned in the slides, but it also might look like weight loss resistance or a lot of weight loss, allergies, fatigue, micronutrient deficiencies, rashes, inflammation, autoimmune activation. It might look like insomnia in children, frequent leg cramps, increasing food sensitivities, hyperactivity or mood changes...See that's the thing, as @drcharliedc_2.0 was saying, parasites cause symptoms in every single body system.
We WILL be discussing solutions... first steps should always be opening drainage pathways. Making sure having daily && @. sweating, sunshine, deep breathing, etc. more on this to come.
One more crucial aspect of parasites is their ability to protect and harbor in toxins like Lyme, EBV and mold. If you are detoxing from any of those and not taking into consideration parasites, you may be playing a tug of war battle with them which can make it impossible to heal.
Rope Worms: LINK1 LINK2 VIDEO
CHAPTER III Tue VALUE or А Lire
Tuere is a certain class of people in the South known
as "poor whites," noted for their shiftlessness and indolence. These are all native-born Americans. Many of their ancestors were of Anglo-Saxon stock, which has been called “the flower of the race.” Why have they degenerated into this condition of indolence, shiftlessness, and poverty?
A few years ago the cause was dis-
blood of its victim. It takes away from a person all desire and ability to work and makes him “ feel tired all the time.” 3
Besides afflicting two million people with a dreadful
chronic disease and slaughtering thousands of children, this tiny parasite has, it is estimated, cost the South several hundred million dollars by retarding the devel- opment of agriculture and industry.
And yet, amazing as the statement may seem, every victim of hookworm disease may be completely cured at a cost of only sixty cents each, and the disease may be entirely prevented by the most simple precautions.
Some one has put it in this way: “If you owned a
machine that ought to earn $300 a year and it was
covered, and it was found to be chiefly a matter of ill health. A tiny One cause parasite, less than half an inch of shift long and no thicker than a piece '***"*** of sewing thread, was the cause of all the trouble. This little Aookworm has
earning only $100 and you could restore the proper earning power by an expenditure of sixty cents, could there be a better investment for your money ?”
A sixteen-year old boy was so weakened by hook- worm disease that he was scarcely able to do two days work a weck. He was treated, and the hookworms expelled from his body. During the next five weeks he gained seventeen and a half pounds in weight while he was working six days cach week.
This is only one striking example of the needless waste of human life that is going on in the United States.
How THE ноок- WORM DEVELOPS. 1-7, segmentation of the egg; 8-16, the embryo; 11, the worm escap-
shell; 12-13, empty shells
through the skin, finds its way to the intestines, hooks itself on to the intestinal wall, and slowly drains the
Newly Discovered Rope Worm Infections: First Case Report in Gulf Cooperation Council Countries
Ali Sher”, Saif A. Latif?
lInfectious Diseases Hospital Laboratories, Ministry of Health, Kuwait City, Kuwait. 2North Khaitan Clinic, Ministry of Health, Kuwait City, Kuwait.
DOI: 10.4236/oalib.1108196 PDF HTML XML 28 Downloads 5,017 Views
Abstract Rope worms are anaerobic worms that were discovered in 2009 during the cleansing of the colon by coffee or cleansing enemas. They are rope-like meter-long intestinal parasites and look like twisted
fibres of rope attached to the intestinal wall. Thousands of people have passed the rope worms in
worm passing in stool, identify them and treat the patient. Morphology: The rope worms look like a
rope and slimy in nature and over a meter long. They were identified in five different developmental Worm1 stages based on their morphology. Clinical Symptoms: The rope worm produces a slimy sticky Wo rm2 substance with a distinct odour, twists like a corkscrew, and may obstruct the intestine. It may also Worm3 cause abdominal pain, bloating, gases, indigestion, and constipation. Conclusion: The patients were Worm4
Never touch them Really never touch them
treated several times in the area clinic with anthelminthic drugs with no improvement of symptoms.
The patients were unable to pass the stool without water or milk rectal enemas.
4. PARASITES
Do parasites cause symptoms of depression? LINK
HEALTH
Over 50% Of Liberal, White Women Under 30 Have A
Define Mental Illness.
Apr 13th 2021+ (0) 7 min read
Are antidepressants designed to treat the symptoms of depression or to cure the patient of depression? Which would be better for the patient? Which would be better for the drug manufacturer?
Why do anti-depression medications not work in long-term studies? LINK
Do human emotions stem from chemicals secreted by glands in the human body?
Do parasites feed on the chemical secretions from these glands?
Would parasitic infection cause a chemical imbalance leading to depression and other mental illnesses?
Do antidepressants cause an artificial increase to these chemicals?
Would this result in a ‘return to normalcy’? [temporary]
Would the artificial increase of these chemical secretions [food source for parasite] result in an increase to the number of parasites in the host?
Would this ‘increase in parasites’ once again deplete the body of the chemicals needed for mental well-being? Would this require an increased dosage in medication to ‘return to normalcy’?
Would this increased dosage cause an even greater increase in parasites?
Why do anti-depression medications [really] not work in the long-term?
Define Addiction. j — -
It gets worse. а
30
Can parasites cause neurological disorders?
Jun Ma, Jun-Jun He, Jun-Ling Hou, Chun-Xue Zhou, Fu-Kai Zhang, Hany M. Elsheikha ©) & Xing-Quan Zhu
Parasites & Vectors 12, Article number: 373 (2019) | Cite this article
1401 Accesses | 7 Citations | 1 Altmetric | Metrics
Abstract
Background
The protozoan parasite Toxoplasma gondii infects and alters the neurotransmission in cerebral cortex and other brain regions, leading to neurobehavioral and neuropathologic changes in humans and animals. However, the molecules that contribute to these changes
remain largely unknown.
@ sciencealert.com/mind-altering-parasite-transmitted-by-cats-linked-to-several-brain-disorders
Mind-Altering Cat Parasite Just Go Linked to A Whole Lot of Neurological Disorders
HEALTH 14September 2017 By PETER DOCKRILL
Can parasites cause anxiety?
The role of parasites and pathogens in influencing generalised anxiety and predation-
related fear in the mammalian central nervous
system
Alain Pham/Unsplash
Maya Kaushik, Poppy H.L. Lamberton, Joanne P. Webster 3, &
The brain-dwelling parasite Toxoplasma gondiiis estimated to be hosted by at least 2 billion people around the world, and new evidence suggests the lodger could be more dangerous than we think.
Show more v
+ AddtoMendeley 33 Cite
While the protozoan invader poses the greatest risk to developing foetuses infected in the womb, new research suggests the parasite could alter and
amplify a range of neurological disorders, including epilepsy, Alzheimer's, and Parkinson's, and also cancer.
https://doi.org/10.1016/j.yhbeh.2012.04.002 Get rights and со
Abstract
This article is part of a Special Issue “Neuroendocrine-Immune Axis in Health and Disease.”
Behavioural and neurophysiological traits and responses associated with anxiety and predation-related fear have been well documented in rodent models. Certain parasites and pathogens which rely on predation for transmission appear able to manipulate these, often innate, traits to increase the likelihood of their life-cycle being completed. This can occur through a range of mechanisms, such as alteration of hormonal and neurotransmitter communication and/or direct interference with the neurons and brain regions that mediate behavioural expression. Whilst some post-infection behavioural changes may reflect ‘general sickness’ or a pathological by-product of infection, others may have a specific adaptive advantage to the parasite and be indicative of active manipulation of host behaviour. Here we review the key mechanisms by which anxiety and predation-related fears are controlled in mammals, before exploring evidence for how some infectious agents may manipulate these mechanisms. The protozoan Toxoplasma gondii, the causative agent
31
Can parasites eat brain tissue?
Naegleria Fowleri cases are being reported throughout certain regions of the United States Credit: Alamy
What is brain-eating amoeba?
Naegleria fowleri, commonly referred to as the "brain-eating amoeba," is a free-living microscopic amoeba that can cause a devastating brain disease.
The parasite enters through the nose and into the brain where it turns into Primary Amebic Meningoencephalitis (PAM), which is a disease of the central nervous system.
If parasites eat brain tissue, could parasites be the cause of Alzheimer's Disease?
Could Toxoplasma gondii have any role in Alzheimer disease?
Ozge Yilmaz Kusbeci 1, Ozlem Мітап, Mehmet Yaman, Orhan Cem Aktepe, Suleyman Yazar
Affiliations + expand PMID: 20921875 DOI: 10.1097/WAD.0b013e3181f73bc2
Abstract
Background: Alzheimer disease (AD), a chronic progressive neurodegenerative disorder, has a mainly unknown multifactorial etiology. Neuroinflammatory mechanisms might contribute to the cascade of events leading to neuronal degeneration. Central nervous system infections have been previously suggested as possible etiological agents in the development of sporadic AD. Toxoplasmosis can be associated with various neuropsychiatric disorders. In this study, we aimed to investigate the possible association between toxoplasma infection and AD.
Methods: This study evaluated the serum anti-Toxoplasma gondii IgG levels. It included an age- matched and sex-matched study and control groups that consisted of 34 patients with AD and 37 healthy individuals, respectively. There were no difference between the socio economic states of the patients and control subjects. serecm anti-I-gondi IgG levels were measured by using ELISA.
Results: According to the statistical analysis, there were no significant differences among the patients and the control participants with respect to age (68.05: 15.98, 62.91+5.89 y, P=0.072; respectively) and sex. The seropositivity rate for anti-T. gondii IgG antibodies among AD patients and control groups were 44.1% and 24.3%, respectively, and there was significant difference between the serum anti-T. gondii 196 levels (Р-0.005).
mechanisms of AD. If confirmed, a positive correlation between toxoplasmosis and AD may lead to new approaches for the management of AD.
Can parasites cause schizophrenia?
J.P Webster D, P.H.L Lamberton, С.А Donnelly and E.F Torrey Published: 17 January 2006 https://doi.org/10.1098/rspb.2005.3413 Abstract
inderstand transmissil infectious causation of both acute and chronic d
and neuropathological studies indicate that
dii. Reasons for this includ
Are brain-eating parasites the cause of insanity? PSYCHOPATH
It gets worse.
33
Can parasites manipulate their host into committing suicide?
Suicidal Crickets
Hairworms have a perpetual challenge: They infect landlubbing insects like crickets,
but the parasites must make their way to an aquatic habitat in order to reproduce.
Researchers at France's Centre National de la Recherche Scientifique figured out how they accomplish this feat. Hairworms produce mind-controlling chemicals that cause their cricket host to move toward light. Because water bodies reflect moonlight, this
often sends crickets toward lakes and streams.
The crickets jump in and drown, and the hairworms emerge, ready to find their next
victim. 5
html
© American Psychiatric Association .. H umans
GAPAPsychiatric By Stephanie Pappas published July 02, 2012
The (9CDCgov is warning of an accelerating осеооо mental health crisis among adolescents,
with more than 4 in 10 teens reporting that
they feel “persistently sad or hopeless,” and
1 іп 5 saying they have contemplated
suicide.
pubmed.ncbi.nIm.nih.gov/21
Brain parasites and suicide
David Lester |
Affiliations + expand Women infected with the cat parasite Toxoplasma gondii are more likely to
PMID: 21117467 DOI: 10.2466/12.13.PR0.107.5.424 attempt suicide than non-infected women, new research finds. The reason for this connection, however, remains mysterious
Abstract
In a sample of 20 European nations, the prevalence of the brain parasite Toxoplasma gondii was positively associated with national suicide rates for men and women.
@ medicalnewstoday.com/articles/24923
Common Parasite Linked To Suicide Risk
Testing positive for a common parasite that lives in the bodies of 10 - 20% of Americans is linked to a sevenfold higher risk of attempted suicide according to new research.
This was the main finding of a study appearing in the August issue of The Journal of Clinical
Psychiatry that supports growing evidence linking infection by the ЖЕСІРДІ) parasite to suicide attempts.
It gets worse.
seroprevalence of antibodies to T. gondii in people with schizophrenia is significantly higher than in control populations (OR=2.73, Р<0.000001).191 A 2009 summary of studies found that suicide attempters had far more indicative (IgG) antibodies than mental health inpatients without a suicide attempt.[19?! Infection was also shown to be associated with suicide in women over the age of 60. (P<0.005) 11931
Can parasites use epigenetics to suppress certain genes in a host? Can it select which genes are expressed?
Т. gondii has been shown to alterithesbehavior of infected rodents in ways that increase the rodents’ chances of being preyed upon by ?еііі 11111511161 Support for this "manipulation hypothesis" stems from studies showing T. gondii-infected rats have a decreased aversion to cat urine.'""! Because cats are the only hosts within which T. gondii can sexually reproduce to complete and begin its lifecycle, such behavioral manipulations are thought to be evolutionary adaptations that increase the parasite's reproductive success. |!!! The rats would not shy away from areas where cats live and would also be less able to escape should a cat try to prey on them. The primary mechanisms of T. gondii-induced behavioral changes in rodents is now known to occur through epigenetic remodeling in neurons which govern the associated behaviors; [7118] for example, it modifies epigenetic methylation to cause hypomethylation of arginine vasopressin-related genes in the medial amygdala to greatly decrease predator aversion." 7/18] widespread histone-lysine acetylation in cortical astrocytes appears to be another epigenetic mechanism employed by Т. gondii. Differences in aversion to cat urine are observed between non-infected and infected humans and sex differences within these groups were apparent, too.21]
manage it. Now a new study suggests H H that A т can turn its host’s https:/ / archive.is/ 03yIB
genes on and off — and it's possible other parasites use this strategy.
[19][20]
Average facial landmarks
Can epigenetic remodeling change a host's appearance?
Could it change it enough to make the infected detectable by a trained observer?
s" -for gay
Ever notice that all the most diabolical villains throughout cartoon history all share the same distinguishing features?
Parasitic and pathogenic fungi form symbiotic relationships with other living organisms, similarly to mycorrhizal fungi; however, they benefit to the detriment (and sometimes death) of their host. Many species affect trees and other plants. Others attack mushrooms, sometimes rendering the host species unrecognizable.
35
If parasites can change the appearance of its host, would this explain the ‘numale’ look?
above - a fragment of the Sixte Chapel fresco "Тһе Last Judgment" painted by Michelangelo (1475-1564).
Below is the current mayor of Chicago. Actions.
лом yee
Q & pubmed.ncbi.nim.nih.gov/23225875/
> J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635.
Jaroslav Flegr !
Affiliations + expand PMID: 23225875 DOI: 10.1242/jeb.073635
Abstract
The parasitic protozoan Toxoplasma gondii infects about one-third of the population of developed countries. The life-long presence of dormant stages of this parasite in the brain and muscular tissues of infected humans is usually considered asymptomatic from the clinical point of view. In the past 20 years, research performed mostly on military personnel, university students, pregnant women and blood donors has shown that this ‘asymptomatic’ disease has a large influence on various aspects of human life.
View Same Google іб SsuceNAO Trace & bunkercuck jpg, 149KiB, 797x758 Anonymous ID:d0990zwM Mon 20 Sep 2021 21:50:05 No.340115610 ™ Report
»muh А.І. facial composites
It stands to reason that a lifelong, behavior-changing parasitic infection could do the same.
Worm pill status: taken
37
Is promiscuous sex rampant in college? Would such promiscuous behavior expose otherwise healthy individuals to new parasitic infections?
Would such infections then cause the host to CHANGE?
AntesDepoisDaFederal lantes/depois
^ 1310
AntesDepoisDaFederal lantes/depois
I$ antes/depois
—
So whose gonna take one for the team and kill Kavanaugh?
n 28.5
Can parasites turn a creature trans?
Home / Science & Nature / Marine Science
Undersea parasite turns male mud crabs female
Marine Science, Science & Nature
The world is full of parasites that can force their hosts to do strange, even suicidal, things. But very few can functionally switch an animals gender. One such parasite lurks in
Chesapeake Bay: an invasive barnacle that hijacks a mud crab’s reproductive system and
Image above: A mud crab infected with parasites. The sacs on its abdomen contain thousands of
parasite larvae the crab will
The invasive parasite
Loxothylacus panopaei (Loxo for short) is a type of barnacle, but looks and acts nothing like the typical barnacles growing on rocks along the shoreline. Loxo has a highly evolved life cycle, essentially custom-made for acting as a crab parasite. As a free-swimming larva, Loxo resembles a typical barnacle larva. A female larva infects a recently molted crab by burying into its shell. Once inside, she undergoes a series of changes and assumes control over the host crab,
dictating major functions such as molting and reproduction.
Abstract
Gender identity disorder (GID), recently renamed gender dysphoria (GD), is a rare condition characterized by an incongruity between gender identity and biological sex. Clinical evidence suggests that schizophrenia occurs in patients with GID at rates higher than in the general population and that patients with GID may have schizophrenia-like personality traits. Conversely, patients with schizophrenia may experience alterations in gender identity and gender role perception. Neurobiological research, including brain imaging and studies of finger length ratio and handedness, suggests that both these disorders are associated with altered cerebral sexual dimorphism and changes in cerebral lateralization. Various mechanisms, such as Toxoplasma infection, reduced levels of brain-derived neurotrophic factor (BDNF), early childhood adversity, and links with autism spectrum disorders, may account for some of this overlap. The implications of this association for further research are discussed.
16/0960-0760(95)00062-5.
> J Steroid Biochem Mol Biol. 1995 Jun;52 doi: 10.10
Sex hormone changes induced by the parasite lead to feminization of the male host in murine Taenia crassiceps cysticercosis
C Larralde 1, J Morales, | Terrazas, Т Govezensky, M С Romano
amano bapana MEN What happens if your endocrine system gets PMID: 7779761 DOI: 10.1016/0960-0760(95)00062-5 disrupted? LINK
Abstract Female mice are more susceptible to Taenia crassiceps (TC) infection than males, However, after a
month parasite load increases massively in both genders reaching thousands of parasites per host. The possibility of hormonal changes in the infected mice was envisaged. Sex hormones levels were
Watching the parasites fully transition a host can now be seen thanks to digital recording and online upload- ing by the infected:
Is he gay?
> м x) 001/1156
Гат Gay (Coming Out Story)
ЕЗ Gigi Gorgeous Subscribed Ж 2299604 2,877,807 views
wm gus
Is he transgender?
b м 4) 0007408
Is he a lesbian?
P» м 4) 004/828
I'm a Lesbian | Gigi
Gigi Gorgeous ^
Is he a dog lover?
М 4) 001/1254
| HAD SEX WITH А DOG | Gigi 5 сс Gorgeous
^
..or is he just infected? UM 41
#4: one of the most common parasites in the US can cause people to become tráns.
#5: this same parasite is linked to causing suicide in the host.
Are trans people known for high rates of suicide?
& hrcorg/news/new-study-reveals-shocking-rates-of-attempted-suicide-among-trans-adolescen
New Study Reveals Shocking Rates of Attempted Suicide Among Trans Adolescents
by HRCStatt - September 12, 2018
Harrowing statistics from a study revealed alarming levels of attempted suicide among
transgender youth. Post submitted by former Editorial Producer, Print and Digital Media Rokia Hassanein
Harrowing statistics from a study recently published by the American Academy of Pediatrics revealed alarming levels of attempted suicide among transgender youth -- with the highest rates among transgender boys and non-binary youth. The findings emphasize the urgency of building welcoming and safe communities for LGBTQ
young people, particularly for transgender youth.
said they attempted suicide. Among non-binary youth, 41.8 percent of respondents
stated that they had attempted suicide at some point in their lives.
Can parasites manipulate a host’s endocrine system? LINK
Would the same parasite that locates a different gland in a different host, then manifest different changes in
the second host? Q @ pubmed.ncbi.nim.nih.gov/23225873/
Glenn A McConkey 1, Heather L Martin, Greg С Bristow, Joanne P Webster
Affiliations + expand PMID: 23225873 PMCID: PMC3515035 DOI: 10.1242/jeb.074153 Free PMC article
Abstract
Parasite location has been proposed as an important factor in the behavioural сһапде 31 7T 1
rodents infected with the protozoan Toxoplasma gondii. During the chronic stages of infection, encysted parasites are found in the brain but it remains unclear whether the parasite has tropism for specific brain regions. Parasite tissue cysts are found in all brain areas with some, but not all, prior studies reporting higher numbers located in the amygdala and frontal cortex. A stochastic process of parasite location does not, however, seem to explain the distinct and often subtle changes observed in rodent behaviour. One factor that could contribute to the specific changes is increased dopamine production by T. gondii. Recently, it was found that cells encysted with parasites in the brains of experimentally infected rodents have high levels of dopamine and that the parasite encodes a tyrosine hydroxylase, the rate-limiting enzyme in the synthesis of this neurotransmitter. A mechanism is proposed that could explain the behaviour changes due to parasite regulation of dopamine. This could have important implications for T. gondii infections in humans.
If one location of the brain was infected, could March 2019 (32)- Now(35). Faking happy versus actual happy. 27 months this result in the host acting homosexual, but if a ыды Always wanted a cute goth girlfriend, but then I became her. different location was infected, could this result
in the host acting like a tranny? Or a furry?
Or any other kind of degeneracy?
What are sexual fetishes? What [really] causes sexual fetishes?
| Anonymous 03/02/12(Fri)17:39 No. 1921453
If only you knew how bad things really are
43
Michelle Obama's librar
htups://weh.archive.org/web/20190908169014/https:/ /www.pinknews.co.uk/2017/10/1/7 an-amazing-demon-drag-queen-has-entertained-children-in-michelle-obamas-library/
Dancing with your pet worm: LINK
Can parasites give you a sadomasochism fetish? LINK Have you ever wondered why some girls always fall for “bad guys"? [they are infected]
The Relation of Toxoplasma Infection and Sexual Attraction to Fear, Danger, Pain, and Submissiveness Jaroslav Flegr, Radim Kuba
First Published August 1, 2016 | Research Article | 8) Check for updates https://doi.org/10.1177/1474704916659746
Article information v | Altmetric 340 Ó
Abstract
Behavioral patterns, including sexual behavioral patterns, are usually understood as biological adaptations increasing the fitness of their carriers. Many parasites, so-called manipulators, are known to induce changes
cats, Toxoplasma gondii. The most remarkable change is the fatal attraction phenomenon, the switch of infected mice's and rat's native fear of the smell of cats toward an attraction to this smell. The stimuli that activate fear-related circuits in healthy rodents start to also activate sex-related circuits in the infected animals. An analogy of the fatal attraction phenomenon has also been observed in infected humans} Therefore, we tried to test a hypothesis that sexual arousal by fear-, violence-, and danger-related stimuli occurs more frequently in Toxoplasma-infected subjects. A cross-sectional cohort study performed on 36,564 subjects (5,087 Toxoplasma free and 741 Toxoplasma infected) showed that infected and noninfected subjects differ in their sexual behavior, fantasies, and preferences when age, health, and the size of the place where they spent childhood were controlled (F(24, 3719) = 2.800, p < .0001). In agreement with our a
priori hypothesis, infected subjects are more often aroused by their own fear, danger, and sexual submission
Can parasites change your sexual preferences?
news.stanford.edu/news/201
brain lights up v
anticipation of ro
is are fluorescently
Why change the host’s sexual preferences? Is it because parasites are using sex to infect new hosts?
45
Can parasites change your sexual preferences? LINK Can parasitic infection turn you gay?
& pubmed.ncbi.nlm.nih.gov/2959888/ Q P gov
> Nutr Health. 1987;5(1-2):95-7. doi: 10.1177/026010608700500212.
М Nilsson 1, O Lindahl, L Lindwall
Affiliations + expand PMID: 2959888 DOI: 10.1177/026010608700500212
Abstract
Feeding rabbits with mycelium from Fusarium roseum is shown to produce infertility, the disappearance of aggressivity, and homosexual behaviour in males, while the effect of the females is only infertility. This mycelium contains the mycotoxin zearalenon which has effects similar to those of the female hormone. This fungus willingly grows on common crops and is consumed both by people and animals-although normally in very low doses. It cannot be ruled out that an increased growth of fungus, due to artificial fertilization, which then can be demonstrated to be found in food and consumed, can be a factor which increases the incidence of homosexual behavior in people.
Do you have indoor plumbing? 5 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3232942/
J Clin Microbiol. 2011 Dec; 49(12): 4264—4272. PMCID: PMC3232942 doi: 10.1128/JCM.05468-11 PMID: 21976755
Widespread Occurrence of Diverse Human Pathogenic Types of the Fungus Fusarium Detected in Plumbing Drains — +
Dylan P. б. Short, Kerry O'Donnell? Ning Zhang? Jean H. Juba,’ and David M. Geiser’
» Author information > Article notes + Copyright and License information Disclaimer
Associated Data
+ Supplementary Materials
ABSTRACT Goto: »
O Anonymous (ID: Ф127) zz 10/05/21(Tue)12:33:12 No.342235198 >
| had crazy anal fixation until | dewormed myself, now the thought of sticking my dick in a pooper is fucking grossing me out. what in the fuck ??? Also why do you guys buy all kind of crystal lady suplements | went to the pharmacy and just told the lady | had worms and didn't know which so she gave me some meds that work against many kinds and took the top dose.
Homosexuals have an astoundingly high rate of infection by parasites. According to the national institute of health, 70% of all homosexual men are infected with intestinal parasites, as opposed to only 10% of straight men. https://pubmed.ncbi.nlm.nih.gov/7437971/
This astoundingly high rate of infection by parasites might then explain why homosexuals have such an increased urge to fornicate. These intestinal parasites always need new hosts. Without a viable vector of transmission, the parasite dies. The incredibly high rate of parasitic infection amongst the homosexual population explains why they are so sexually degenerate. Their behavior is being altered in much the same way as the rat's behavior is altered by toxoplasma Gondi in order to allow to parasite to survive.
= ж
This would also explain why the media is freaking out about ivermectin. Ivermectin is potentially the most effective parasite removing drug available. An anecdotal case in my family gives me strong suspicion that ivermectin might actually be a cure for homosexuality. My cousin was a homosexual, until he was prescribed ivermectin for covid. After taking ivermectin, he filled a toilet bowl with intestinal worms. Shortly thereafter, he lost all attraction to men, and found women sexually attractive. He was repulsed by his previous nature.
t. gondii homosexual
Web Images Videos
Any time d
Advanced
Central-nervous-system toxoplasmosis in homosexual men and ... https://www.ncbi.nim.nih.gov/pubmed/6691657 Anonymous View Ann Intern Med. 1984 Jan;100(1):36-42. Central-nervous-system toxoplasmosis in homosexual
теп and parenteral drug abusers. Wong В, Gold JW, Brown AE, ...
Does Toxoplasma infection increase sexual masochism and ... - NCBI https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5731508/ Anonymous View Nov 28, 2017 ... Other factors correlated with toxoplasmosis, e.g., zoophilia and homosexual sex
(not the homosexual orientation), had no direct relation to ...
Toxoplasma gondii - RationalWiki https://rationalwiki.org/wiki/Toxoplasma gondii Anonymous View Toxoplasma gondii is a parasitic protozoan that causes toxoplasmosis in humans and .... It's possible that the initial association of T. gondii with homosexuality is ...
The Relation of Toxoplasma Infection and Sexual Attraction to Fear ... https://journals.sagepub.com/doi/full/10.1177/1474704916659746 Anonymous View Aug 1, 2016 ... Keywords Toxoplasma gondii, sexual behavior, sadism, sexual domination, ... It
has been, for example, suggested that male homosexuality can ..
іп a controlled study 67.596 of 200 homosexual men but only 16% of 100 heterosexual men were found to be infected with intestinal parasites.
Is this really me? Parasites and other humans' cells in our b
https;//www.ncbi.nlm.nih.gov/pmc/articles/PMC1704818/
The emergence and spread of intestinal parasites is of public health concern particularly in the homosexual community.
https://www.researchgate.net/publication/267 16190 _Sexual_transmission_of_intestinal_parasites_in_men_who_have_sex_with_men
These findings suggest that E. histolytica is a common commensal in the homosexual population
https://www.nejm.org/doi/full/10.1056/NEJM 198608073 150603
76/133 (57 96) asymptomatic homosexual men harboured intestinal parasites.
https://www.tandfonline.com/doi/abs/10.3109/00365548409087142? ournalCode-infd19
) = 10/01/21(Ғгі)22:11:23 No.341715263 > ms.png (3.67 MB, 1300x1300)
22341699221 Fucking nuts.
When I was in Navy bootcamp circa 2011 there was a guy that came out of the head looking frightened as fuck. Something was off about him though. He was kind of walking differently, like he was іп a rush but he seemed more collected. Turns out he filled up the shitter with worms. He said later he could see them “writhing” around in the shit. | chocked it up to the galley not cleaning and accepting subpar ingredients. But we all noticed he dropped his affected gay accent- you know the kind that gay guys universally attempt.
Anyways, he stuck around a couple of days until he could be discharged. He didn't do the same walk or gesticulations and he stopped affecting that accent altogether. One guy, a nuke who maxed his ASVAB score, told me he thought they put something in the food that made him shit out parasites. | though he was crazy and just assumed Occam's Razor, still assuming it was the galley's lack of cleanliness and all that. But the nuke told me one more thing: that the guy confessed to not being gay anymore. He was revolted he told us all the shit he used to do and would like to do once he got out. He was a completely different person.
-All т saying is that maybe this is more than random 4chan bullshit posts. It's anecdotal, like OPs pic, but there's something to it all.
@ ncbi.nlm.nih.gov/pmc/articles/PMC269003/
m Journal of Ea, | Clinical Microbiology’
J Clin Microbiol. 1986 Oct; 24(4): 684—685. PMCID: PMC269003 doi: 10.1128/jcm.24.4 684-685 1986 PMID: 2877006
Prevalence of enteric parasites in homosexual patients attending an outpatient clinic. C S Peters, R Sable, W M Janda, AL Chittom, and F E Kocka
» Copyright and License information Disclaimer This article has been cited by other articles in PMC.
Abstract
A total of 372 pooled stool specimens from 274 homosexual men with diarrhea were submitted for parasitologic examination over a 2.5-year period. Each two-vial pooled specimen set contained portions of stool from 3 consecutive days in Formalin and polyvinyl alcohol. Of the 274 patients, 133 (48.595) harbored one or more intestinal protozoa, with 161 (43.396) of the 372 specimens submitted being positive for one or more organisms. The parasites identified included Entamoeba histolytica (71 patients), Giardia lamblia (22 patients), Endolimax nana (106 patients), Entamoeba coli (39 patients), Entamoeba hartmanni (25 patients), Dientamoeba fragilis (3 patients), lodamoeba bütschlii (2 patients), and Chilomastix mesnili (2 patients). Cryptosporidium sp. (2 patients) and Isospora belli (1 patient) were also detected. Results of this study support the experience of other workers regarding high rates of infection with intestinal parasites in the homosexual population and also indicate that symptomatic individuals belonging to this acquired immunodeficiency syndrome risk group be screened for both common and uncommon intestinal pathogens.
ЕСЕ This woman can kill the “worms” that turned you gay
By Daniel Villarreal April 24, 2019 at 10:04am - 53 comments
https://www. queerty.com/woman-can-kill-sperm- hungry-anal-worms-turned-gay-20190424
г i ы ч
Dr. Mariam Al-Sohel has some meds for you, but they aren’t oral.
Meet Dr. Mariam Al-Sohel, a supposed “Kuwait! New-Age Therapist and Human Development Advisor.” She has discovered therapeutic suppositories that'll curb your excessive homosexual urges. That's right!
While science still struggles to understand whether homosexuality Is caused by genetics, social factors or Just normal human desire, Al-Sohel knows what actually causes teh gay — and It ain't genetics.
She explains: "The sexual urge develops when a person Is sexually attacked and afterwards it persists, because there Is an anal worm that feeds on semen."
“Praise be to Allah,” the show's host says. Related: New Pill Will “Cure” Homosexuality In 8 Sad, Delusional Months
Walt a sec... so being raped or molested somehow causes an anal worm to spontaneously grow іп your butt? Intriguing! Please, continue doctor: “So what | did was to produce suppositories, which are to be used by certain people at a certain time, and It cures those urges by exterminating the worm that feeds on sperm."
ous (ID: GHEE) = 09/28/21(Tue)09:45:02 No.341254452 |» >>341254585 >>341254733 >>341256151 >>341256765
>>341253329 They release toxins into the stomach and brain. Used to Бе a fag until | detoxxed myself. Getting rid of parasites and worms isn't a meme. | broke up after detoxing myself after having a relationship for 3 years. Feels disgusting to think back about what 1 did.
nonymous (ID: ШЕШЕ) = 09/28/21(Tue)10:40:10 No.341260569 >
>>341260021 Hope it works fren. | noticed a different after the first try, then soon after the gay went away. You might get some headaches but that's the parasites being gassed. Getting extra iodine into your system might also help as protection, but I'd first try the shit | recommended.
nonymous (ID: CHEE) = 09/28/21(Тие)10:18:01 Мо.341258041 P >>341250681
>>341256765
>The worm made me lazy and unfocused,
Yeah same here. I never was hedonistic in the sense of fucking everything that walked past, neither was the ex, guess that is the exception to the rule. Also | started to lose weight pretty easily again, depressed moods stopped and the alcohol and sugar cravings stopped right away, both two things parasites and worms love. Brain fog and feeling like total shit in the morning also is gone. | too feel reborn.
How to cure the Gay: LINK
49
Do homosexuality and trannyism appear to be infectious diseases, epidemiologically?
Is it far more frequent in children raised in densely populated areas?
Does it occur in some societies and not others?
Is it spreading at an accelerating rate? Number of Pediatric бепдег Сііпіс5 in 2007.
MONTANA MINNESOTA Ottawa Montreal 11 Toronto
Define Outbreak.
New York NU
WIJSITE солт Q
Houston
FLORIDA
үз
as ‘LGBIQIA+’
A leaked internal message reveals the
elementary school teacher who claims
over 60 percent of her students are LGBTQIA+ also said it is not enough’ to
just celebrate 'Queer folx.'
Are there multiple subtypes of gay men?
Are we looking at multiple opportunistic species?
Or are different "types" of gays just at different stages of the parasite's lifecycle? Or do they represent people with active infections and people in remission?
Americans who self -identified as LGBTQ in 2021, by generation za 112,415 U.S. ueluti Conducted betwee
It is spreading like a disease because it is one.
, Мі: lenials odxvx4QZ
Gen X
Бот E
Baby boomers i3
Traditionalists
[^]
50
Describes a person trying to acquire PARASITES
The doctor said, "This patient is regularly having unprotected sex with different partners. He might be a bug chaser."
New Member Username: Curndmp
Post Number: 1 Registered: 04-2008
Username: Vinsteri
Post Number: 32 Registered: 07-2007
Posted on Monday, June 01, 2009 - 06:35 pm:
I met this dude online today. Big 8 1/2 poz dick. I got him talking about it. Said his strain was strong. Lethal. Toxic. Poison. My dick fuking sprang up and I started begging him.
I went over... I started hitting my pipe, he did a slam. I licked him blood off his arm. I had to have his strain. I wanted him to infect me so bad.
I was begging for it and he went to the bathroom. He came back with a syringe full of his blood. I'd never had another dude's blood before. 1 stuck my hole up and he shot it inside me.. scratching around. Then he fucked me and he shot.. mixing his babies with his toxic blood.
So fucking hot. I know I'm gonna get a whole fuck flu from this shit. It's so strong.
Then I went to the bookstore and let 5 dudes fuck me and grind it all into me. I'd never had something so hot inside me. I had to get it to take.
He's gonna start knocking me up regularly and 1 can't wait till his shit is saturating me and producing inside of me. Woof.
Posted on Monday, June 01, 2009 - 07:35 pm: FUCKING HOT. GO FOR IT. I WOULD
Posted on Monday, June 01, 2009 - 07:39 pm:
Wow. Made me instanTly hard. Did you hiT the pipe, too? Or slam?
Posted on Tuesday, June 02, 2009 - 12:05 pm:
that sounds fucking hot man, love feedin on blood like that too and love tops gettin off on sharing all they've got
51
P Я r/TrueOffMyChest [ Join | t1 Toxic Masc @ Retweeted u/ButteredSalmon * 1y
Poz Breeder А 4 я @PozBreeder As a bug chaser, going out in public
without a mask is very sexually exciting. My fave pig І knocked up and who | still
Many people think bug chasing is limited to the breed just found out he knocked up his
reception HIV, however to some people like myself, first bottom bitch. My strain lives on. catching other diseases can provide the same kind #poz #gifted #bbbh of thrill that a bug chaser gets when being intimate
with someone who has HIV. ТҮРЕН ҚАРЫНЫ
The other day | walked into my local supermarket 7 Retweets 32 Likes
and immediately felt a tingle of sexual excitement
as | was the only one in sight without a mask on.
As | continued through the store | found myself Q у Q М walking against the guided routes that shoppers
are supposed to follow and breathing as heavily as Ф Larry Hewes & @Poz4Chasers · 2d possible to satisfy my sexual desires. Even the looks Replying to @PozBreeder
| got from the Karens couldn't stop the rush | was Congratulations on your new "grandson"! So getting. | know that wearing a mask and following glad to hear that his "father" is still toxic. Are safety procedures is extremely important right now, you still toxic? And аге any of you 3 guys
i 1 "aeree qum s but | have never felt so alive than | was when I was in interested In being Gifters? There are a hundred that store chasers for every Gifter globally. | am glad to
refer all Gifters to chasers in their area.
T Vote ғ, C) 5 ac Share Tweet your reply
I've been rock hard since І found out. | talked to my wife and she promised that he'd always be wearing a condom. My wife is currently pregnant and the idea that only a thin bit of latex prevents his supercharged POZZED load from infecting my wife and her baby is the most erotic thing ever!
85598100 >>388598919 >>388599486 >>388599500 >>388599648 >>388600076 >>388600376 >>388600575 >>388600676 >>388601460
Toxic: Carrying AlDS/other diseases.
Strain: The strain of HIV a person is carrying which they imaginarily lend significance and empowerment to, claiming their strain is strong and others should want to be infected with it
Gifter: Someone who gives the gift of AIDS to others.
Bug chaser: Someone who actively seeks out and fetishizes infection by AIDS as the gay version of getting pregnant
Breeding: Ejaculating inside another man's rectum with HIV positive semen to infect them with the virus
Impregnating: Infecting someone with the virus
IV Drip: Doing a direct blood transfusion of a gifter's AIDS blood
Funneling: Accumulating numerous positive men's semen into a container and pouring it into an opened rectum with a funnel for the purpose of infection with AIDS
Doublebugged (and triple, quadruple, etc): Being infected with multiple strains of AIDS from multiple gifters intentionally.
Pig: A submissive male who enjoys being penetrated by other males and in particular enjoys it in an unclean manner involving unshowered, sweaty men often with an element of feces or urine.
San Francisco Special: Having a party in which multiple gifters infect other bugchasers with the virus as the basis of the gathering
Initiation: A ceremonial infection of a new gifter to begin breeding and impregnating others with AIDS.
Xenomorph: An HIV positive gay man who preys on negative gay men to infect them without them knowing, and then is sexually aroused by the thought of the virus surprising them from within their bodies like giving birth to a horrible monstrosity.
Cocktail: A mixture of multiple HIV positive men's semen
Sounding Spreading: The spreading of the AIDS virus by injecting infected semen into the urethra of the recipient instead of the rectum
Black Bug Chasers: Gay men who specifically seek out infection with HIV from black men under believe that black HIV is superior.
Zyklon-B: A term used to refer to infected semen being put into a Jewish gay man.
Why do social media platforms censor facts but allow pedophilia advocates? LINK Why is pedophilia protected by those with power? LINK
Is there an advantage to the parasite when the parasite infects a young host?
Does a child's weaker immune system make it more susceptible to parasite infection?
Category: Child Health Topic: Infections and Parasites Ез Send by email [xj Viewas PDF &3 Send by post
Threadworms, also called pinworms, are tiny, very thin white worms about 5 millimetres long that live in the intestine and around the anus (bottom). They are very common and widespread in Australia and are easily treated. Although people of any age can get them, with the infection spread through worm eggs on contaminated surfaces. Infection with other worms such as roundworms, hookworms and tapeworms is less common.
Can the parasite gain greater control over the host the longer the parasite remains inside the host? How do homosexuals reproduce?
Do parasites influence the host to engage in pedophilia in order to spread to more vulnerable hosts? Who is Wilhelm Reich?
Why did he conclude that sexual degeneracy was communicable?
What is the average age of a homosexual's first sexual encounter?
How do homosexuals [really] reproduce?
RAMROD - ^ Description etka: Alex Garcia бола .» RAMROD, South Florida's Levi/Leather/Uniform/Bear Bar is the South's #1 About > Yesterday at 1108 AM Cruise bar. Discussi
ies ATTENTION!!! Ramrod is a Leather,Levi and Uniform Bar. We are | Alex's post welcoming to all Patrons that identify as such. Leather/Kinkster Folks of all Members identities are welcome and will be treated with Respect. Ramrod does not Events BI condone any Racist, Transphobic, ог Misogynistic Behavior in our
establishment. Also remember Consent is not just sexy its MANDATORY!!!
Videos
Photos Pig Dance is an institution here in South Florida. 1st Saturday of every
Recommendations
The 3rd Friday of Every month we host ManDance, this is the biggest Bear
h oup Q CUT Я Dance Party in town. Hosts some of the hottest DJs in town. Jeff CubHunter 6 5g J Paul-Anthony Andrada 6, Played Dr. @ an early age. With school Ej Denis Sabol 13 Like - 1d оа 5 Е kids my own аде!!!!Кеаѕоп why I'm Top/Vers. 1 Оов Like · 1а А 5 Like - 1d - Edited " i SELIM GRD 15) у Lj Sosa | think | was around 7. It was just curious boy stuff. Like - 1d (ез Rob Velasco 17 Like - 1d Оз: Mido Mido Craig J. Chamber! t pus ido Mido Crai amberlain i want you E 9 ! y Жж Rober Isidoro Gomez Castillejo 14 ma Like - 4h ve | Jerry Meek 19 i Gerald Johnson 5 1 Like - 1d - Edited а= n Like - 1d Like · 1d Michael Wesley 14 b Tips ud E Jose Calera 14 | was and still am the bottom ЖЕ E Like - 1d 2 David McCartney Was born with one. О Dominick King 8 years old a Like - 1d Ов : Like - 1d 5 Like - 1d Louis C Harris 10 =a A > - a Paul Wright 8 Qi з : Like · 1d 2 Kerry Herbags 21. | think | was a late bloomer. dir David Hughes 9 ike 3 Like - 1d Like - 1d Jordan Miguel Adı 16 "n ordan Miguel Adorno A Mark Reilly 12 ' Like - 1d vd Brian Thornton 14 Qa? Kk Jesus Ramirez 7 Like - 1d ры М | m 4 2 Like - 1d Like - 1d ayne Smith 1 И 2 m Velvet Hammerschidt 12 Like - 1d Chad Davis So early | can't remember Qa? т Adam Gregory 15 іп a glory hole in public toilets 282 Р Like - 1d Os: Mi R Obert LeFevre 18 asia Like - 1d rt Бы лд Аы 6 Rodney Nelson 11 Like - 1d кі Donnie Wayne 6 - 7 Qu [| Jerry Schooley 10.... with neighbors grandson on top of sta m Qoa: Like - 1d old newspapers in her garage ! Still love that ink smell! e
53
ВЕ Kelly Farmer 14 О:
Like · 1d
E Mido Mido Kelly Farmer so handsome
Like - 4h
Like - 1d
Bl Dane Sheldon Rod Paul Andrés Exactly the same!
Like - 1d
a John Perry 13 Like - 1d o:
Darrll Morales 20 Like - 1d
Rod Paul Andrés 4 but the first time | enjoyed it was 16
«225
о 2 Like - 1d
ж Hide 14 Replies
Ronald L Peck 13 Like - 1d
Gary Simons 16 Like 14
Chet Ford 8 with a cousin who was 12 and һе has a 11.5 inch cock I think that's why | am a bottom now
Ose"
Qo:
Mark Miller-Schott 10 mas
Е
Bob Lilly 611 (is 5 Like · 1d
Like - 1d - Edited
Philip La Vigna was 5 grade. but relly around 5 with a boy г
Like - 1d
Michael Harness 15 Like - 1d
E Bob Lilly It was a cousin and we fooled around for years.
о:
Rod Раш Andrés Dane, don't get me wrong, it wasn't horrible, | just couldn't comprehend what was really happening. It began at 4 could have been a little earlier, | have some strange memories but can't be certain they're not manufactured, and went through 13 with various individuals.
When 16, | became involved with a military person 20 years older... looking back | recognize that these individuals were child predators. No harm, | survived and don't have any ill will towards them.
[E
Like 14
Dane Sheldon | was tied to a tree and forced to perform oral. Had numerous additional unwelcome experiences. Finally had a nice experience when | was in my late teens. Still harbor some resentment towards the original perpetrator but have become comfortable with myself, with who | am, and what | enjoy (albeit a little different than most).
Like · 1d a N Eric Heiselt 15 - scout camp; real sex was 18 with my hockey coach 4 Like - 1d os
У
Ally Тот Ifamilik М Eric Heiselt that must be hot?? Like - 23h
М Eric Heiselt Ally Tom Ifamilik didn't appreciate it then. But | still love a hairy daddy with a touch of silver. Yummm
Like - 23h
View 4 more replies
Mark Williams 19... Raped by my dad in 5th & 6 th grades but. 8
Like
м
1d - Edited
Ally Tom Ifamilik Mark Williams for real tho?? No way. Like - 23h
Mark Williams Ally, | entered male survivors of sexual abuse therapy in January 2011. Finally, | began to deal with the loss of my childhood.
О:
Like - 21h
Like - 1d
M Bob Bier Chet Ford hopefully you and your cousin still hook
up Like - 1d
e:
Chet Ford Bob Bier no we haven't hooked up since he was 19 and | was 15
Like - 1d
Mark Parker Chet Ford wow! Start big or go һоте!! Like · 1d
Chet Ford Mark Parker it hurt like hell. Got used to it when I
was 12
Like - 1d o р Bob Bier Chet Ford 4 years of hurt, that's a long time
Like · 1d
Chet Ford Bob Bier well we didn't see each other that much between the first time and until | was 12 then | started to like it. That might be why I like big cock now. Don't get me wrong a nice average cock is nice but the bigger ones are nicer
Like - 1d
Fredrick McLeod | was raped by my dad at 3
Ва
|Ы Kelly Paris sorry to hear that!
Шке 1d
Fred Mclean Fredrick McLeod so sorry to read that Like - d o:
Fredrick McLeod He raped me again at 18. The only reason | even went back around him was for my grandmother. Now | am free from him.
ё
Like - 22h
L Те О: ke]
Draigh Lunara 12 and a half
Ally Tom Ifamilik Mark Williams man | dont understand stand.. your dad raped you?? That is nuts..
Like · 18h
David Andreas VonLuvinbalz 12. Red head 9” older Daddy
Ose:
Like - 1d
к
Bob Bier David Andreas VonLuvinbalz voluntary? Like · 1а
David Andreas VonLuvinbalz Bob Bier yes. | initiated Like - 14h
dia Оз:
Z£ABABEH PEP E
Brent Ard Somewhere between 8-10.
Оз:
Like - 1d
Mike Stonecypher 11
Like - 1d Like - 1d
Leoke Picqueur 8
Оз:
Like - 1d
Colt Harrell 7 3 Jose Rivera 14 delicious Оз
о 1 Like - 1d Like - 1d
Brad York 11 with a cousin Brent Thomas Hill 16
Like - 1d 05 2 Like - 1d
Alex Warner 17 honestly George Fain 20
Like - 1d Like 14
Edmund DeSantis 23 Andrew Jones 13 QQ 2
Like - 1d Like - 1d - Edited Joe Paul 17 Daniel Miles 14 Like - 1d Like · 1d Scott Smith 7 4 David Ayotte 24 Оз Like - 1d Like - 1d
Rod Reynolds 17 Lie Id
кимна ШЕН
Stephen Folse 12
Q:
Like · 1d
Brian Young-Walls 7, with my best friend.
Like 1d Оз s
Jeff Beacom 10 with a kid my own age. 16 with a guy in his 30s
Mark Hill 11 (Du 1
Like - 1d
Like - 1d
Like - 1d - Edited
Like - 1d Ted Moxley ! guess 8 or 9 playin with buddies mine was always hard theirs weren't... && Ой:
Chen Elbilia 5-6 raped by a neighbor
9:
к Bob Bier Chen Elbilia @
Like - 1d
Norman Stanbury 11 Like - 1d о:
Bob Bier 26 for blow, 28 for anal От
о 2 Like - 1d
Henry Martin 13
1 Like - 1d
Chris Perez 5 (Dis 5 Like - 1d
Greg Nixon 14 Like - 1d
Michael Hoyh 7 Оз:
Like - 1d
Gary Robert Potter 14 Like - 1d
Scott Haldeman 12 Like - 1d 2 2
Matthew J. Zafferas 12
Like - 1d
Eric Gunderson 11 0:
li EE Eg EE HW
Like - 1d
ою
54
EOS ju
БЕРР
Like · 1d
Like - 1d
Like · 1d
Allen Belluomini 18. Late bloomer. But I've made up for lost time.
02%:
Like - 1d
Jim Madigan 12 Like · 1d
Casey Lloyd Ford 14 Like - 1d ;
David Wasserman 5 or 6 Like · 1d » 6
Bob Lilly David Wasserman me tool
Qa:
Like - 1d
David Wasserman Bob Lilly My brother's and my best friend's
lá Оз:
Like - 1d
Bob Lilly David Wasserman my cousin and his friend they were in their teens!!! And my father did too! | didn't like that at all. But had too!!! Ugh! He finally moved away with another
guyl 1 Like - td @
Bob Lilly My father | mean. But the others were greatll!
Like · 23h
Billy Bowles 12
Like - 4d j
Filimon Campos 16 Like - 1d
Mike Roth 11 (Dis 2 Like - 1d
Brent Ard Somewhere between 8-10.
Oa:
Like 14
Mike Stonecypher 11
Like - 1d
John Whitlock 24 Like - 1d
Justin Richardson 11
ues Ой? Matías Roberto 16 Like · 1d
Joshua Bowman 12
о:
Like - 1d
Arthur Danby 14 Like - 1d
Richard Navarro-Vincent 25 Like · 1d Joe Murray 12
2
Like 1d
Dave Carey 7 ©) 4 Like - 1d
Ronald Podesta | was 10
3 Like - 1d Өз Chad A-bomb Prince 21 Like - 1d
Scott Smith 7 to 14 much older cousin 14 to 18 Reverend Foxworthy
[E
Jay Dick 13 Like «© p
Michael Hochhalter 8
On:
David Kerr 8 Э | Michael Vargas | was б not going into details to dark and pervy for Like - 1d 0: the book. Enjoy ur day oa: John Gonzales 12 on an 18 year old hairy guy && Like - 1d Like - 1d Roberto Vela 37 Like - 1d MI Bob Bier Michael Vargas willing & or forced 3 ? Angelo Russo 20 with а fiend |5 very beautiful Like 1d Like - 1d - Edited
William R Altmeyer 21
Michael Vargas Bob Bier mixed Leo-Hubert G Kelly 13 or 14
Like - 1d Like · 1d Like - 1d William Dangler 12 Qo? Kelly Paris Happened to me at the same age as well Jackie L Walton 34 Like · 1а Like 1а Like - 1d
Rik Hepner Womb outing day, was part of my original equipment
Michael Vargas Kelly Paris so u get it Kevin T Casey 8
E Fok SE
Dennis Eveleigh 43 Tom Penman 15 Michael Peacock 7 Like - 1d "
Like - 1d Like - 1d о У Like · 1d Ou? Gordon Nesheim 14 Uke 1d strict Catholic upbringing 3 Like - 1d Ruben Ortiz 11 a meta о 1 3 Wyatt Greenmen Was а couple older boys about 16. | " a Kelly Paris Michael Vargas yeah. Not sure if your experience remember incredible excitement. Would re-live it in a was like mine, but there ya have it. heartbeat ... Derek Bennett 4 or 5. Next time was much later, thank god O82 os Like · 1d Like · 1d Like - 1d ғ Michael Vargas Yea my father raised те... alone... just hima Ef Wyatt Greenmen Not sure what the teary face is for! Omega J LaRue 9 andi Like - 13h 2 іке like- 4d Ox? Like · 14 o Rene Martin Murillo 9-10 Tony Rocha 43 о 2 1 Е Tai Toki-Rogers 11, the boy next door. We were at it until | turned wa Joe Skelly 11 Like · 1d Like - 1d 17 1 А о > Like · 1d 3 K Like - 1d » 1 bill; Richard Surles Jr 14 Ellas Abilama 22 №. Jose 5 Hernandez DAMN | Was The Neighborhood Slut Like · 1d Like - 1d m William Jones Ten year old Can't Even Remember My Age о 1 | Was In Grade School LOL Garret Coleman | was 10 Jere Douglas 8 Eee Like - 1d 1 2 Like · 1d © Like - 1d E James Beaton 11 өй Mason Wagoner 17 Carl m] 2 Eee ESS) cu" Like - 1d ; Like - 1d Like 14 Е Clint McKellar 22 < o: LE] Ole AHemness 7 Keith Boswell 22 Sebastian Alex 24 oiii Lie - td Like - td Like - 1d & уд Albert Hoffman 6 David Leh 12 Michael n a. renee Like - 4d : Like - 1а Like - 1d E] Anthony Vito Raimondi 16 with a classmate к Vaibhav Dhariwal 15 Like - 1d David Aird 21 Doug Bowers 22 Like - 1d Like 14 Like - 1d A
Josh Becker 12 Bi
1 Flint Ternes 14 Like - 1d Like 14 o Ken Dunning 11/12 1 Like - 1d David Edgar 14 5 ? Like - 1d Jan Rejfek | had always dick 25 Richard Brown 16 Like - 1d 2 Michael Gee 14
Like - 1d Like - 1d
Like - 1d Robert Ledwell 12
Like · 1d
Mario Andre Quiroz 15 Jonathan Goeldner 12, with a friend doing an overnight Like - 1d Oo: Like - 1d
Michael Booth 6 but first full on man to man sex when | knew what |
JOUET wanted was at 16 lost my anal virginity at a tender age of 48
Chadwick Gray 10. With my best friends brother next door. He was
12 at the time. Like - td Like - 1d Os: ©? Like - 1d М сааи James Long Townsend 14 Шке · 1d 4 Michael Morejon 10. Like · 1d a о 1 Like - 14 Willem Marais 16 Randy Frazer 12yo Like · 1d e Jeffrey Todd Ollom 13 Like - 1d ID 21
Like - 1d Colin De Jongh us Jeff Kendall 45
Like - 1d
Michael Fellenz 9 От
Like 1d
Like 1d Hugh Grant 23 ish
Like - 1d
Jerry Calderon 16 Lee Hamilton 14 and loved it Like · 1d Like - 1d Luke а те John Рашк 15
Like · 1d Mark A Geraghty 12 but it wasn't consent
Like - 1d Like - 1d Жы?
Tony Kaplan 18 my step brother Timothy Saathoff 13 with my best friend
Like - 1d
B eM:
Chris McGaughey 10 in showers after p.e
B mE: X€zmoMEUmseu s»mGgHY3»» Ó3»"m:gus-eor
he oe eee a AMANRNAR
Like - 1d Qo? Like - 1d Mickey Braden 12 Ref Cagle-Foster 7 : Like - 1d Larry Avi Lucas Macias 15 and it was Hugh and hut &3 2, Fred Lewis 14 Like - 1d - Edited —
Like - 1d
RL Adams Last week! 92 @
Like - 1d о ы
Lee Mcallister good lord so many of you where so young ,, те | was 19
Like - 1d o:
Gerald Shockley 14 Like - 1d
Craig Pennison 14 after school Darwin Israel 15
ШІ Ken Leedham Lee Mcallister | was 12 and loved every
moment Like · 1d Like - 1d
Like - 23h СА
"S Jackson Stivers 13 Ryan Koch-Cate 23 Like - 1d Like - 1d
Elvar Jakobsson 16
Like · 1d Randy Friedman 18 Brian OBrien 15
Like - 1d Like - 1d
Ed Gary Poole Don't remember. The neighbor boys and | played naked it our tree fort a lot. One older boy like to be tied up and spanked. | think | lived in a kinky wooded suburb looking back on it.
mom ERES Zziul
E.A. Sabol Consenting, | was 11. Without my consent, | was a Joseph James Brennan 12. Haven't stopped since toddler. Tome 02:
Like - 1d Like - 1d LEE 55
zz aEGENMOSO:
нсана A
Chris Nevins 4th or 5th grade! 9 or 10
Steve Nolan 15 or so. 1st cousin about 2 years older broke me in.
Wilfred D Tremblay 13
1 Like - 1d Like - 1d o Like - 1d Paul Breakiron Gave my first blow job at 16......it was with consent Уш George Hughes 14. Buti was raised in midtown Manhattan. ES Dennis Benson Depends - willingly ~ 15. Like - 1d Like - 4d Like - td o: ЕЕ Jamie Solomon Paul Breakiron your very sexy ғ Eddie Hughes 11. Gave ту 1st blow job to a neighborhood best Ы Ben Bristow 13 Like - 1d тета o: Like - 4d Like - 1d Billy White 7 " id Charles Randall 10 — zh David Hopkins 24 зерт 1 Like - 1d Bryon Juarez 13, my Cousin ші Bishop Andrew 16 Like - 1d By Benjamin DeLee 8 ike O82 Like - 1d Like - 1d Anderson M. Christopher 12 а Raven Oh 17 Ж John Каре Benjamin DeLee really!? Like 1d Like · 1d Like - 1d Kerry Chapman 3rd grade m Stephen Robinson 22 but I'm tied with McDonald's now... over a regen BN Benjamin DeLee indeed Billion served ike Like · 23h Like - 1d - Edited Os : Lou Gonzales Yesterday y Like - 1d Os Wilfred D Tremblay 13 J Charles Michaelson 14. A few weeks after | lost my virginity to my Like - 1d then girlfriend Samuel Vanwert 11 | was a early bloomer loved it then love it now Like - 1d and I'm 63 E Dennis Benson Depends - willingly — 15. Like · 1d Q: Like - 1а o: ә John Paver 9 Ken Irvine 12 or 13. Like - 1d Like - 23h Mike Harrison 5 years old haven't stopped yet am 63 now is Tony Englefield 9 Like 1а оё: teu O: A William Hugh Moultrie 12 Irving Smith Convertino 16 Like - 1d Like - 23h ІН Glenn Monte Mike Harrison that's sad 1:4) Alex Panagopoulos 13 Like - 23h T o: Е Edward Cichocki 9 Jose 255 8. Like 1d Like - 23h ГЕ | Mike Harrison Glenn Monte | know it wasn't а good thing but 4, Michael Wilshinsky 14 really did want it and liked it i Q: Like - 1d ) Terrell Cleland 14 Monte Miller 15 Like 23Һ А Like · 1d Like - 23h " 5 Danny Douglas 26 | | Rene Ortiz Mike Harrison me too. | was really bad. Год — 1 = Michael Hubbard 9 James Arnold 7 ыды Like - 1d Like - 23h : TS ille 18.1 Th SUN ЕН Ж Parker Раш 16, but if we're counting being molested 4 rev Summerville 18. In a sauna. The guy was al sucke 4 Victor Rietveld 10 him off and spat it out. then he sucked me and swallowed the lot. Like - 1d 2 Е? Daniel Huffman 18 Ы > Never saw him again Like - 1d Like - 23h ob Lilly Parker Paul Like - 1d 1 Bob Lilly Parker Paul [8 Jim Gallucci 16 Wilton Knight 10 Lee Gunner Was | think 7 or 8 ( dark times ) not given willingly Like - 1d Like - 1d Like - 23h
Like - 23h “ р
Staash Lazarick First time a guy had MY аск. І was 13. һе was 20 2
Like - 23h
Ken Phillips 19 Like · 23h
Brad Martin 9 or 10 Like · 23h
Russell Elenz 13 and never have know anything other than теп!
Like - 23h Manny M. Ж Jeb Montoya 18 Like - 23h Like - 23h a Grover Tesser Manny Velez atta boy 7 14 a Brodie Yg 13 Like · 23h Like - 23h = Rexx Pike 13 Like - 23h m Rick Marion 12
Like - 23h
Ы Grover Tesser Eddy Martinez @xeellentil You needed dick. 4%
Like · 23h
Edward Wanda Wednesday Sawyer 10 he was 12 Like - 22h о 1
Ronald Akin 24 Like - 22h
Edward Costello 14
Like - 22h Mike Davis 4 or 5 ше 2љ ©?
Grover Tesser Mike Davis man after my heart. Wish ме had been neighbors sneaking around to share cocks.
о:
Like - 22h
Daimeon Pilcher doesn't mean you weren't molested. A 5 year old isn't expected to fully know wrong from right and the person you were with took advantage of that.
От
Like - 22h
Grover Tesser Serious dick with cum 9 He was older. Played p p at 6 with chums of same age.
OB:
Like - 23h
E Bob Lilly Grover Tesser oops!!! Did not mean angry!!! Sorry. Like - 23h
Grover Tesser Bob Lilly No problem if you did mean it. | was having a great time. 7%” О:
Like - 23h
Bob Lilly Grover Tesser no didn't mean ІШІ | was having fun then 100!!!
Шке: 1d
Kelly Paris Grover, how old was the guy you had fun with when you were 9?
Like 14
Grover Tesser Bob Lilly if guys are honest..]| bet 87% of us. o5
Like 14
ЖІ Bob Lilly Grover Tesser so ітие! | really enjoyed ІШІ 1 Like- 1d
Thomas Farley 12
1 Like - 23h
George Dominguez 9
1 Like - 22h
Darrell Moore 12
Like - 22h
Like - 22h
Shawn P Murphy 13 2
Like - 22h
Antonio Miguel Spinoza Following, 13 Like - 22h
B Spencer Richards | was 18 the first time | had a man cock От ©
Bob A. RaNeses 21, college buddy
Like - 22h
56
Jimmy Brindle | was 15
V Ai - & Е e e
Like - 23h David Mellinger 20
Philip Smith 8 Like - 23h
Like - 23h
Scott Masters 16 Like - 23h
Adam Walder Probably around 13 Like - 23h
Manny Velez 8 years old BJ LaRouech 11
2 1 Like - 23h Like - 1d о Lary Wayne Wadsworth 7 Q? Like - 23h
Michael Gordon 5 Like - 23h
B Michael Gordon ves
От
Like - 23h
E Michael Gordon | always was gay no women here Like - 23h
Richard Barragan 5 years old
2$:
Like - 23h
Perry Hummer 12 Like - 23h
Jaime PB 21 Like - 23h
Allan Spach 12 Like - 23h
Michael Greck 13
Like - 23h
| ШІ ^
Jim Martin 11 Like - 21h Danny Dupree 6 neighbor friend
Like - 21h o:
а Grover Теѕѕег Danny Dupree yes Danny. And what a beautiful name. It just feels good in mouth and even better when it rolls past my lips. Great name buddy. 9)
Like - 21h
Alex Ray 11 Q 1 Like - 21h
Guy D Broome 5 Like - 21h
Michael Edwards 12
Os:
Like - 20h
[^3 Jaycee Hammer Did your older brother top you? Like - 20h
Scott Coleman Michael Edwards me tool 4 2 & Like - 20h
Michael Edwards Jaycee Hammer no Like - 20h
Rodney Davis 15 Like · 20h
Steven Rees 13 years old Like - 20h
Harry Orama | was very young 5ish 6.it was my uncle,
| thought you had to be with men, | did like it, one of my favorite role model was "speed racer”
| remember one time kissing the t.v cartoon character and my mom saw me and she's like, no you don't do that, | was like really , but i love this man mom, well at least in my mind | told her, but i was. smart, | start it doing behind her back! Hehe
The time | was with a woman was back in 1985, never looked back !
О:
Like - 20h
Joseph Bernard Snyder 6 yrs old
Like - 19h :
Brandon Perez Emnace Id never fucked but oral, | do at 9. Only oral up until now, but never fucked a guy.
Like - 19h - Edited
Scott Carpenter 11
© 8
Mickey W. Kean 15
Christopher James Shipp Touched my uncles cock when | was 5! Had sex when | was 19 Оё:
Like - 21h - Edited
E Bob Lilly Christopher James Shipp he never said anything? Like - 21h
Patrick M Kearns 18yrs Like - 21h
Erik S Malm 30 Like - 21h
Damien Ruud 21 Like - 21h o : Anthony Alleycat Fióre 15
Like · 21h
Jeff T Huckaby 10, the 14 year old boy across the street... and the 11 year old boy on the corner. Sleepevers galore with the three of us. Good times. Lots of frottage and touching.
От
Like - 21h Edited
Dean Davis 6 Like - 21h o:
Dan Gerrell 9 ©) 2 Like - 20h
[1 Dan Gerrell No need to cry, it was with an 11 y/o and boys were boys... shit Magnum PI changed my life before that happened... Lol
ғ
Like - 18h - Edited
Alec Edwin Porter 7-8
к ei
Like - 20h
Ey Edward Paul Alec Edwin Porter same Like · 19h
ЁЙ Steve Steffen Edward Paul , thats too bad, soo not right Like - 19h
Patt Copeland-Griggs 16 Like - 20h
Brad Diffenderfer 13, my brothers BFF. Off and on for 2-3 years.
Like - 19h
Nightwolfe Lockwood-Park 6
E ет
Like · 19h
Tony King-Watkins Oral 8, anal 16 Like - 21h o: E Bob Lilly Tony King-Watkins who at 8?
Like · 21h
Bi Tony King-Watkins Bob Lilly my 16 year old foster brother
Qo:
Like · 21h
Bob Lilly Tony King-Watkins my 15 year old cousin started me on him at 5. He had me sucking him for many yrs. Untill he got married.
Like 21h
Tim Harter 15 and have loved it ever since Like · 21h Brandon Coon 12 years old, Boy Scout camping trip. Shared a tent with three other guys.
1 Like - 20h o
Scotty Allen 16 Like - 20h
Jordan Clevenger My current age, 2122
о:
Like - 20h
Jack Harrold 14 Like - 20h
Douglas OKeeffe Oral 20, anal 21 Like - 20h
Michael Dalme 25. | made up for it though lol Like - 20h
Greig Shortreed 12
[E
Like - 20h
Bryan Greeley 15 with a 24 yr old and | thought he was old Like - 20h
Marq Kerr 17 didnt like it thought | wasnt gay until | fuck a guy when I was 20
Like · 19h
Eddy Cross 4 Like - 19h
ШІ Eday cross why the frown face nun?
Like - 4m
Gary Morse 8 my neighbors son until 11
Like - 19h Like - 18h Ш Don Jones Way before | was a teenager, | don’t even know the Like - 19h Pasquale Valentino 15 СЕ e: x T Brandon Corbitt 8 Like - 19h 83 Scott Smith 9 "al Clint Bordwell 5 ike Like - 48h Like - 18h isch 0) Markus Georg Enders 7 John Paulk 14 Like - 19h С m Merk Jones 16 Like - 18h Mike Allshouse 10 Chris Capps 18 ike Like - 18h Like - 18h Like - 16h Mitch Orr 8 L Sion Corn My own when | was about six ^ — $ Thom Lauth 21 AETA оо 2 Anthony Galvin 8 Kevin Wright 24 Like - 18h Like - 17h Like - 16h i Jeff Osmond 11 1 саша 79 B p Mark Porter | was born with a dick? Like - 19h I eet Like - 18h Р) E Randy Crank-Heflin 18 Like - 18h Like - 17h Е = Like - 16h Jamie Todd YT 10 to suck 13 getting fucked E Dene ataa am OE Like - 19h 02: WHEE EES Like · 18h Troy Duncan In my late 30s ІШІ Like - 18h 5 Like - 17h igs Like - 16h Mark Dwayne Turberville Jr. 13 Stephen Jackson 11 L5] dp ke] Paul Holbrook 13 ike Arthur Silver 12 Eie don Like · 17h FN ii Like - 16h Heath NaughTeeboy Tanner 9 with my older brother and then 11 Scott Clink 15 ЕҢ Philip J Morganti 8 with my 23 year old neighbor. Still play with brother on occasion. Yup Like - 17h 11 Robert Dulworth 12 I'm a total pig! Like - 17h Like - 16h Оза: [3 Ben Rice 21 Like - 16h Like - 14h A Stacy Sanders Burge 13. a Chris Resto à Б Heath NaughTeeboy Tanner Dont be sad....i pursued them Like - 17h when I ned iyoo not tie oiher way сола became ап (ЖШ Jeremiah Miller 11 Like - 12h escort at 14 and loves it. Now at prefer to be a one man e pig. | dont enjoy multiple partners any more. Like: 14h ы Б eves к Раш Winchester Five Like - 7h Uter A Like - 12h LE
Daemon Nushi 7, some random in a toilet. He picked me up, split me in 2 and held me close as he pounded my hole. Will never forget him
Like - 15h
Steven Miller 26
Siler Wesley 9 and lov
Like - 14h
Patrick Eaton 11 yo, played with cousin same age
Like 14h
Michael Vinci 9...was molested by a 70 year old man!
A z
Like - 15h Like - 14h
Allen Ray Feeman | had to be about 15. us John Geraghty 12 ж Christopher Lonkey 7
Like - 15h Like - 11h Like - 8h 42:
Ricky A Lenart 22 David Mott 5 9D з M] Grover Tesser Christopher Lockey БЕНЕН Like · 15h Like - 11h Like - 8h !
57
[4 Joey Spriggs Paul Winchester 5 Like - 6h
Anthony Payne 16 Like - 12h
Brian Petersen 29 Like - 12h
Paul Bryan 13 Like - 12h
Randy S. Kidwell 14. My brothers От
Like - 11h
David Keith Duffey 14
Like - 15h
Larry Cotton Markee Kershner 8th grade Like - 15h
Travis Finn 7 1
Like
6h
Grover Tesser Travis Finn hope itwas consensual. If it was
my hat is tipped to you buddy. Like - 6h
Travis Finn Grover Tesser It was totally consensual and started off as touching and progressed from there.
@ Grover Tesser David Мо
Like - 11h
Mark Orman 3rd grade
Like - 8h «2 5
a Grover Tesser Mark Orman m Like - 8h
Like · 5h
However I Love it now ! Like · 4h
Grover Tesser Ron Boatriont [hope tnat it was consensual: If so my hat is tipped off to you. | knew | was fascinated by crotches at 3. Played with a couple of cousins at 6. Had my
first dick with cum at 9. High school boy. He turned me on to a couple of his horny friends. Loved suckin their cocks.
Ron Boatwright Grover Tesser no it wasn't | was a baby.
©
1
? Michael Browne Young
Les Wright 8 from my cousinin the Army m
Like - 9h Leston Buell 19 maybe? ғ
Like - 9h
David Douglas Smith 9 Like - 9h
Like 5h Mark Andrew Priest 12 L2 e: Like - 5h el Buddy Reeder 12 ru Like - 5h Q:
Like - 11h
Like - 10h
Michael Benjamin 12 or 13
Like - 10h
Frank Lopez About 6 or 7. Like - 10h е : Perry Hummer 12
Like · 7h
Rick Schneiter 15 Like - 7h
Ken Harrison 12
1 Like - 6h
Aurthur King 12
1 Like - 6h
Q'
ізі Carlos Р Glinzman-Murphy 9 or 10
Like - 3h
О:
Grover Tesser Travis Finn
| put out signals and innuendo. Sure they were older. But nobody was lurking in the bushes offering me candy to suck their cocks.
Grover Tesser Ron Boatwright bless you buddy. Thank my. оџ are a survivor. Men and cocks and cum, not to mention balls and an ass to eat are the best things in life. Maybe too much to question but | am interested. Do you feel your very early experience swayed your sexuality? | was born
Mark Jump Sr 8 , old man neighbor made me kiss him and fondle him, but loved playing with my same age friends, then in my teens my older brother friends would come over while my brother was away and lay naked on me humping and a lot of frottage, | loved it, then | tried to live a straight life until my early fifties started with cock again at 51, now I'm 61 and still can't get enough, want it all the time
gay. Have never been with a woman. Lucky to have had the
most understanding parents in the world from the get-go. Like - 5h
ғ.
Like - 3h Like - 3h
Doug Reiss Depends on what way.... first time someone had mine (in a way) | was 14. Went home with someone at age 18. Got very
Larry Laura Grey Dees 7 and I'd do it all over again
«25:
Alex Vázquez 17
От
Joe Robinson 15
Like - 2h Like - 1h
Gregory D. Felten 12
Like - 4h Sick afterwards (and | know why). œ 1Reply Ll Chadley Dunn 13. It was awesome. He got me into my fetish for Like - 2h o: ma guys with a hairy ass and uncut dick 7 MEL беле аз” Like - 3h еэ m Jerry McCumber 177i think! Hot contractor Ryan Logan 12 1 te m % 1Repy Like - 2h o Like-th 4! 5% Robert Buhrow ШЕ William Bonilla | һауе my own dick since birth A Lance Hilmer 14 Michael J Keith 14 Like - 4h Like - 3h O2: Like - 2h Like - 1h : N Nelson Gonzalez About 8 % 3Replies E Matt Wesson About 12 Rich IE 14 Like - 4h ө?ғ: i ; Eddie Pabon 5 Like · 1h Like - 1h œ 1Reply Like - 3h Оз > = ШЕ Alex MacLeod Matt Wesson 1291 Е meta КВ Егіс Nudelman too old * 3Replies Like - 28m Like - 52m @DO 4 - ike m Like - 3h - Edited 68 Levi Scott LeMay Way too young & no regrets 7 " 5 Rick AndRock | was 10 and my friend was 11. | was his first and he Ф 2Replies Like - 2h was my first. We messed around for a couple years just playing but А this опе night we took it all the way and yes | felt him when he came. Charles Hutton 20 jim Todd Michael Kepus 16 He said he felt me too. We messed around for about 10 more years рит — then we lost touch ike Like - 1h - Edited Osa’
Michael Petersen 17
Like - 2h Ф
Like - 1h
Jim Williams 16 first | sucked him then he bent me over and shoved
itin. He was 44 Оза:
Brett James Still Waiting €5 29
Like · 27m Like · 52m
Manuel Pico 16
Р а
ы Rod Раш Andrés Jim, | was 16 when | got involved with а 36 year old. Knocked on his door, he invited me in. One thing led to another and | ended up being passed around to three others through the evening.
Like - 17m
Skip VandeLinde 5
42:
Like - 51m
о:
Like - 46m
Ruby Morales 12, with my neighbor and best friend who was also 12 for a summer then we moved and | did not have anything until | bottomed at 18. That was awesome. Haven't had any since. | am bi and happily married to a woman.
Оз:
Frank Abbott 18 year old Like - 25m
В Jason Clark Hmmm. Consenusally about 12. Mileages proably 4 or 5
Manuel Pico | let them Catch me Os:
Like - 41m Like - 25m
Luis Hernandez 5 3 Grover Tesser Manuel Pico well somet]
something. GRIN Like - 18m
Like - 40m Fernando Roura | was underage
LE 58 d
Tim J. Stieg About 13 maybe. Maybe 14 Like - 17m
Like - 35m
58
What is Comet Pingpong known for? Why is the Rom-show for “All Ages”?
Comet Ping Pong
\sasHa e] à | PRESENTS fÑ
oct ober 28, 2016 canes ping pong
25 likes
;astanya ,% $ iS
| FOLLOW
Why is the symbol for pedophilia in the shape of a worm?
It gets worse.
5. POLITICS аар
How often should humans be treated for parasites? PARASITE-MARE Surgeons pull dozens
[at least once per year] day How often are Americans treated for parasites? of ‘WRITHING’ parasitic worms from
[Never] boy’s tummy after he became constipated
Gemma Mullin 10 Jun 2019, 15:47 | Updated: 10 Jun 2019, 17:33
American pets are given access to low-cost, over-the- с а counter anti-parasite medication that has no known
side-effects in humans. A FOUR-year-old boy had dozens of parasitic worms removed from his
Yet American humans are not put on regular parasite- | P99v after he complained of feeling constipated.
treatment schedules. Stomach-churning images from the operating room showed a metal bowl filled with the "writhing" creatures.
Reconcile.
Can parasites lobotomize their host? [poor memory and thinking skills]
Parasite >>> Infected Host >>> Poor Critical Thinking Poor Critical Thinking + Mass Media = Control Voters
The 'bundle of live worms' in a metal bowl after being removed from the boy's
What is the [real] reason Americans do not have small intestine Credit: BMC recommended parasite-treatment schedules?
'Bundles of worms'
The team, led by Dr Valirie Ndip Agbor, extracted the "bundles of live worms" through a small incision in the boy's intestine.
Doctors said if the worms had not been removed they could have led to malnutrition, physical growth problems and poor memory and thinking
It gets worse. skills.
He hadn't been "dewormed" since birth - 55:619215 ЕЗ to clear off adult worms and their eggs from the bowel.
60
Can parasites mind control their hosts?
Parasites Practicing Mind Control
AUG. 28, 2014 An unassuming single-celled
organism called Toxoplasma gondii is one of the most successful parasites on Earth, infecting an estimated 11 = percent of Americans and perhaps Carl Zimmer half of all people worldwide. It’s just eU РНИ? as prevalent in many other species of mammals and birds. In a recent study in Ohio, scientists found the parasite in three-quarters of the white-tailed
% * deer they studied. »
One reason for Toxoplasma's success
is its ability to manipulate its hosts.
The parasite can influence their
behavior, so much so that hosts can a put themselves at risk of death.
Scientists first discovered this strange A microscopic cyst in the brain of a mouse containing thousands of Toxoplasma gondii mind control in the 1990s, but it’s parasites. New research has found that the parasite is able to exert a form of mind control by turning its host's genes on and off. Jitenc S.D.A
F«Fnrnm
H
been hard to figure out how they
manage it. Now a new study suggests that Toxoplasma can turn its host's
enes on and off — and it's possible other parasites use this strategy,
The Atlantic
SCIENCE
Neuro-parasitology is an emerging E ^ Я Parasites Can Mind-
branch of science that deals with A е : Қ parasites that can control the nervous er x» "Re ; Control Animals
system of the host. ... Іп some of the most : 4 САТУ АУМ 22 Without Infecting fascinating manipulations, the parasite Ж, 3 АЛЫР Them taps into the host brain neuronal circuities ib қ
to manipulate hosts cognitive functions. ч 2 : In 2018, everything is a metaphor.
1 May 2018 By Ed Yong
® https://wwwrontiersin.org » full Mind Control: How Parasites Manipulate Cognitive Functions in ...
Can humans be controlled by a parasite?
A kingfisher catching a stickleback (Nigel
"We're never ever going to be allowed to do that with humans." In a lab setting, Toxoplasma also binds to dopamine receptors, which are the brain's reward centers. "It's quite possible and plausible that if you have an agent affecting dopamine, it could influence people's behaviors,"
Adamo says. 7Dsg 2012
61
https://www.discovermagazine.com/planet-earth/meet-the-parasites-that-control-human-brains
Meet the Parasites That Control Human Brains
Toxoplasma, brain-infecting amoebas, rabies and more.
By Ben Thomas | Oct 29, 2015 9:00 AM
News > Medscape Medical News
Common Parasite Now Tied to Impaired Cognitive Function
Batya Swift Yasgur, MA, LSW . July 22, 2021
The macabre world of mind-controlling parasites roscience Articos | August 25, 2019
Summary: Understanding how parasites ‘hack’ the brains of their hosts may provide new
insights into decision making and behavior. Log In
Source: Frontiers Username
Imagine a parasite that makes an animal change its habits, guard the parasite’s offspring or even commit suicide. While mind-control may sound like something out of Password a science fiction movie, the phenomenon is very real — and has spawned a new field,
neuro-parasitology. As outlined in an article published in Frontiers in Psychology,
Remember Me
Create
decisions.
Mind Control: How Parasites Manipulate Cognitive Functions in Their Insect Hosts
Wi Frederic Libersat“, F Maayan Kaiser and E. Stav Emanuel
Department of Life Sciences and Zlotowski Center for Neurosciences, Ben-Gurion University of the Negev, Beer-Sheva,
Israel
Neuro-parasitology is an emerging branch of science that deals with parasites that can control the nervous system of the host. It offers the possibility of discovering how one species (the parasite) modifies a particular neural network, and thus particular behaviors, of another
At least now you know what he is talking about: LINK
62
Are parasites used to mind control high-profile targets? [political power, financial power, military power] Would this behavior be considered ‘normal’ or ‘hacked’? LINK1 LINK2
Are high-profile targets sent to special luncheons and dinners?
What is put into the food? Who is spikethechef?
Who is this?
Are ‘hacked’ targets easy to control? What are (((handlers)))?
Parasite hacks and then lobotomizes host. Host's power transfers to (((Handlers))). Vote Red? Vote Blue?
Either way, Power >>> (((Handlers)))
Are mentally ill individuals suitable for public service? Are mentally ill individuals suitable for leadership roles? Are mentally ill individuals suitable for promotion in the military?
Mental illness or brain-parasite?
What if he/she/they/them are purposely infected due to position of power? What if he/she/they/them are promoted and given more power because they are infected?
It gets worse.
64
Can parasites take complete control over a host? LINK
Can controlled hosts infiltrate into high-level government organizations?
Once in position, can controlled hosts pass legislation which supports the spread of parasites?
Would this result in directing scientific funding away from parasite treatments?
Would this result in outlawing Fenbendazole while also mandating Glyphosate?
Can these high-level controlled hosts work to include Polysorbate-80 and aluminum in vaccines?
Can these high-level controlled hosts work to mandate these vaccines?
What happens to the career of medical doctors who suggests something that goes against recommendations of the WHO or CDC? LINK
Why make every effort to ensure that humans are infected by parasites? [the end goal of a parasite is not to kill the host, but to spread more parasites]
When a person of influence does something which goes against common sense, we assume he has been
bribed, black-mailed, threatened... [Wrong] [Wrong] [Wrong]
He has been infected.
Is a controlled host still aware of the actions he performs?
Does a controlled host still feel remorse and guilt, but is unable to stop himself from obeying the parasite? Does this cause a controlled host to wish he could die, but the host is still unable to kill himself? [R9.6] What is the [real] reason suicide rates are so high in the infected?
Who is this?
What were his beliefs in 1960?
His beliefs in 1961?
In 1962?
1963?
1964?
1965?
1966?
[MOST loyal adherent]
Did his beliefs suddenly change in 1967? Did he just suddenly decide to 'change his mind'? OR was his mind changed for him?
Are parasites biological?
What are biological weapons?
65
What is biowarfare?
Are parasites biological?
Can parasites be used as weapons? Can parasites mind control their hosts?
5402 The USA has added another 37 organizations - 34 of them from China — to its list of businesses with which US interests can't interact without a license, with a» 12 of them earning their places for developing "mind control weapons."
As usual, the newly listed organisations earned their place on the grounds their activities represent a threat to national security. Less usually, this batch sees plenty barred for bodgy biotech.
Did the US have a biolab in Lyme, Connecticut, which specialized in tick-borne illnesses? How did Lyme disease get its name?
What insect causes Lyme disease?
Why did the CDC cover up Lyme disease for 45 years?
Is Lyme disease caused by a parasite [bioweapon]?
Have US operatives worked to cover up the cause of other parasitic diseases?
Is Alzheimer’s caused by a parasite [bioweapon]?
'Two decades of Alzheimer's research was based on deliberate fraud by 2 scientists that has cost billions of dollars and millions of lives
Recommended
Countless lives destroyed, billions of dollars lost, so many families torn apart... ...and all just to protect their precious bioweapons.
To protect their precious bioweapons, would they suppress information about other treatments? What is Covid19?
What is hydroxychloroquine [HCQ]?
15 НСО effective against Covid19?
15 НСО effective against parasites?
Did a high-level political figure [45] recently suggest mass-use of HCQ?
15 НСО safe to use in the short-term to treat illness?
Is HCQ even safe to use in the long-term?
@ lupus.org/news/safety-of-long-term-use-of-hydroxychloroquine-therapy-further-verified-for-people-with-lupus
LU 2US Understanding Lupus Living '
FOUNDATION OF AMERICA
Verified for People with Lupus
Hydroxychloroquine (Plaquenil®) was approved by the Food and Drug Administration for symptoms of lupus. The greatest concern people with lupus have when taking hydroxychloroquine is related to vision and an increase in risk for retinal damage. A new investigation analyzed the retinal changes over a five-year period in people with lupus and did not find clinically relevant retinal changes in the group. The study concludes that hydroxychloroquine therapy is use at doses «5 mg/kg/day. Learn about how lupus affects the eyes and hydroxychloroquine.
What effect might a massive application of HCQ have on a population being manipulated by parasites? Would NPCs begin to heal?
Would NPCS begin to regain use of logic and reasoning?
Death knell to (((those in control)))?
How might (((those in control))) react to such a situation? DJ Patriot
Billionaire pharmaceutical company founder Barry and his wife Honey Sherman were murdered in their
Craig "Sawman" Sawyer ™ ind Toronto home on Dec. 15, 2017. @CraigRSawyer They owned Apotex, a manufacturer of generic drugs, specifically HYDROXYCHLOROQUINE.
‘Unexplained’ Explosion Destroys World's Second They manufactured the drug. Largest Hydroxychloroquine Raw Material Factory = =
~\ DrBill @DrBill_ MD.
P» hydroxychloroquine but the | | l pharmacist said the state had
taken over the distribution of the “Unexplained” Explosion Destroys World's Second Largest Hydroxychloroquine R... "A Well, 2020 is refusing to go out without a bang. Literally. An "unexplained" drug. Even though I'm licensed, |
explosion just destroyed the world's second largest hydroxychloroquine raw ... cannot prescribe it. This is & welovetrump.com WRONG!
2:04 PM . Dec 23, 2020 - Twitter for iPh , Р ИЧЕ ii i ы 1:10 PM - 4/5/20 - Twitter for iPhone
Did hydroxychloroquine suddenly become a "life threatening" drug and its use must be immediately banned?
So many different articles written by so many different authors, yet such similar wording:
The largest-yet survey of using a Trump-touted z Study find EECA om a malaria drug t ес as coronavirus cure
(f) Oregonian
in COVID-19 patients
treated with malaria drug hydroxychloroquine: study Chicago Tribune | 2 hours ago
ars
he malaria drug wi
ted by President Donald howed no benefit in а
A malaria dr
no benefit
'ans hospitals. The: he
en hydroxychloroquine v
reported. The nationw
More deaths, no benefitffrom malaria drug in VA virus study
AP Associated Press | 7h а
study was not a ri
4 More Deaths, No Benefit ату Beast | 5 hours ago
obtain death
'ontinued health
ident Donald Trump for ved no benefit in a large
'ans hospitals. There
A malaria drug w
ificates that enable the ge and other benefits, асс о death certificates right
treating the new coronav ho Yem to secure
analy f its use in U.S. v
more deaths
COVID-19 treatment hydroxychloroquine showed{no benefi: more deathdin МА virus study
Ш Fox News | 2 no
Malaria arge study c
d
ury at a very high
can
Study findq more deaths, no benefitffrom
malaria drug touted by President Trump T кноу 14
wing по benefits to patients with
Hydroxychloroquine test in VA study ЕШ Merc g
ed no benefit in a spitals
an А malaria drug
say
ous experiment
NEW: Study shows[no benefitfrom drug touted
by Trump in virus fight El Агата Jou ituti
Study finds|more coronavirus deaths, no benefit from malaria drug touted by Trump
A malaria dr dent Donald Trump for treating th ed no benefit in a a E: 1 Philadelphia 1 analysis of it hospitals. There Е
А malaria dr t by Pr nt Donald Tr г more death: ia dru by President D d Trump fo
standard care.
^ ү туге қ TR Study shows[more deaths, no benefit]ffrom Coronavirus updates ШЕ
malaria drug touted by Trump from NBC News Raleigh № ФА NBC News| 2h
hydroxychloroquine v
treating
analysis of its
more deaths amon
a rigorous experiment.
Drug championed by Trump for coronavirus awaiting validation x Я 37 : oe ‹ ynoa d treatment s y - An ana s
Talking Points Memo
A malaria drug v g the ni
udy " Coronavirus study]More deaths, по benefitffrom
ited by p
out an antibiotic for COVID-19.
More deaths, no benefitffrom malaria drug No benefit, more deaths]Hydroxychloroquine Touted by Trump, coronavirus study finds
lops in VÀ hospitals study T Tampa Bay Times | 1 hou
Ш washington 7 A malaria drug үйде
more deaths amc standard care, re:
But witi
368 pati
not a rigorous experiment. | More deaths, no Бепей тот malaria drug hydroxychloroquine in VA coronavirus study 5
% The Boston е |5
hloroquine ve:
n a retrospective study. which has not yet b
mined patient
Hydroxychloroguine as treatment for COVID-19 showqno benefit and more dearhs[in VA study
W MarketWatch | 5
А malaria drug resident Donald Tru
ias
" President Ti AVA coronavirus study finds Қ” IU potential breakthro
hydroxychloroquine results i ^ і j analysis of its us:
d no benefit in a
treating the n
Salt Lake Tribune | 2 ho
by President Donald Trump for ed no benefit in a large
Thi
A malaria
treating the virus sh
analysis of its и more deaths a
‘Ivermectin: FDA approved drug with over д billion doses administered worldwide, named on W.H.0's List of Essential Medicines and won their
Why did the media never report on the following: LINK inventors the Nobel Prize in Medicine in 2015" (((Who))) controls the media?
Was there are similar response to Ivermectin?
Why did Mass Media run a smear campaign to convince the public that Ivermectin was just horse-paste?
Why did the media never report on the following: LINK ((Who))) [really] controls the media?
It gets worse. 68
What did the CIA mean by this?
Sanitized - Approved For Release : CIA-RDP82-00141R000100290001-2
The article points out that the term in question is purely physio- logical and encompasses substances of very diverse chemical composition; telergons can be proteins, steroids, alcohols, organic acids, etc. Gen- erally, Kirshenblat subdivides telergons into the following categories:
A. Honotelergons -- substances which act on other members of the same species
1. Gonofions, which cause formation of or changes in sex charac- teristics
2. Gamofions, which stimulate maturation of sex glands and re- productive processes
3. Epagons which attract other members of the same species
-- substances which act on animals of other species
Progaptouns, which immobilize or kill prey Aminons, which protect animals from enemies
Likhneumons, which are elaborated by Myrmecophils and termi- ophis and expectorated by ants or termites, on which they e-sġimulating or narcotic effect
Google Scholar хепадопѕ Articles
Any time Your search - xenagons - did not match any articles. Since 2021
Since 2020 Suggestions:
Since 2017
Make sure all words are spelled correctly. Custom range...
Try different keywords.
Try more general keywords.
Sort by relevance Try your query on the entire web Sort by date
Why are they covering up information about xenagons and parasites?
[Maintain control by any means necessary]
69
Can bioweapons be used to perform covert political assassinations with plausible deniability? Are political assassinations performed using 'cancer'?
Who is Bill Oxley?
Or are political assassinations performed using ‘parasites that cause cancer’?
@ researchgate.net/publication/7889939 Pathogenic significance of a-N-acetylgalactosaminidase activity found in the hemagglutinin of influenza virus
Article Nov 2017 - J BUON
@ Ehsan Saburi - € Jalil Tavakkol Afshari - Sajjad Biglari . Yousef Mortazavi
View Show abstract
... Evidence also shows changes in the GalNAc components of the extracellular matrix and extracellular membrane attachment component such as integrins in cancer tissues or cells (16,17). These findings confirm that the presence of Nagalase in many pathogens such as bacteria, parasites and viruses may be effective in their spreading in the body (15,18, 19). One of the most important role of Nagalase has been investigated in macrophage suppression (20). ...
Does aerobic glycolysis of the parasites deplete nearby host cells of oxygen?
Does oxygen depletion result in localized cells being forced into the fermentation-mode of ATP generation? If those cells are locked into fermentation-mode of ATP generation, would this result in a rapidly growing tumor which would soon be destroyed by the body's immune system?
What if the body's immune system is unable to detect the rapidly growing tumor?
What is Nagalase?
The so-called “Nagalase” is an endogenous enzyme that plays a role in sugar metabolism. The scientifically correct name is “N-acetyl- Galactosaminidase". Nagalase can split off certain sugar molecules , namely N - acetyl- galactosamine , from large molecules.
Specifically, Nagalase may split off the N- acetyl galactosamine sugar side chain from the so-called “vitamin D - binding protein” (“DBP”).
DBP is found in serum and is also referred to as ^Gc-Protein".
There is evidence that the Nagalase produced by tumors has an “immuno- suppressive” effect: It is thought that the Nagalse-mediated immune-suppression in cancer patients contributes to the growth of the existing tumor and the formation of metastases.
Do parasites produce Nagalase to hide from the body's immune system?
Does the immunosuppressive effect of Nagalase also prevent the body from locating and removing the abnormally and rapidly growing cells which have been locked into fermentation-mode by parasites which are consuming all localized sugars?
Parasites >>> Force Cells into Fermentation >>> Results in rapidly dividing cells >>> Nagalase >>> Cancer
70
Stages of Parasite infection:
Parasites infect local tissues [Stage 1}
Rapid Parasite growth >>> Parasites burrow deeply into local tissues [Stage 2]
Parasites protect themselves by infecting/damaging lymph nodes [Stage 3]
Parasites get into blood stream and spread to other parts of body — metastaic [Stage 4] No active parasites but inactive parasite larva which may activate years later [Remission]
What other common disease has 4 stages and a remission state? [Cancer]
Parasites >>> Consume local sugars Lack of sugars >>> Force Cells into Fermentation-mode of ATP generation Prolonged Fermentation-mode >>> Uncontrolled, rapid cell-division Parasites release Nagalase to hide from Host’s immune system Nagalase >>> Also hides local cells which are rapidly dividing
.. rapidly dividing
Do parasites cause cancer? LINK
Did a parasite cause your cancer?
18 June 2017
Four common cancers linked to infections
In a research study (Lancet Oncology May 2008) using IARC data, researchers found four common infections linked to a large number of cancers: Human papillomaviruses (HPV), Helicobacter pylori, and hepatitis B and C link to 1.9 million cases of cancer.
While the study reports that these infections are rarer in developed countries, air travel makes everybody vulnerable. "Infections with certain viruses, bacteria and parasites are some of the biggest and preventable causes of cancer worldwide," said Catherine de Martel and Martyn Plummer, who led the study.
Cervical cancer accounted for about half of the infection-related cancers that occurred in women, and liver and stomach cancers accounted for more than 80 per cent of the cases in men.
The term 'parasites' can include parasites themselves (these do not have to be a meter long but can be microbial), viruses, bacteria and yeasts. About 17 per cent of cancers are known to be caused by parasites, the real figure could be even higher, while in some cancers, yeasts are
nonymous (ID: CESAM) = 08/26/22(Fri)23:40:14 No.392743850 »
22392742877 It's more the "by products" of infestation that the body can't isolate, but yes cancer is parasites.
Cleveland Clinic is about the only place in the US that treats parasites. They used to have an article on their website about parasites and breast cancer. They took it down. They studied my friend's case and even came out to visit her and talk to her doctors.
Woman's brain tumor turns out to be parasite growing in her head
A parasite in the brain sounds like the plot of a horror movie, but it's a preventable infection from
tapeworm that can be found in pork. Reminder: are parasites sexually transmitted?
Define 'routine close contact'? Oral Sex and the Alarming Rise of HPV-
Related Throat Cancer in Men
By 2020, the rates of HPV-related oropharyngeal cancer are expected to
surpass those of cervical cancer. So why aren't young men getting vaccinated?
By Kimberly Lawson
A 3D imaging "fly through" shows the location of Rachel Palma's brain lesion. қайнатады We
May 29, 2019, 11:48 AM EDT / Source: TODAY
By A. Pawlowski
Rachel Palma’s symptoms were strange and disturbing: She was having hallucinations, insomnia and “horrific nightmares.” Her right
hand would suddenly give way and she’d drop things. She was
having trouble finding the right words and made alarming phone
sofisrael.com/f
ungus is telltale cancer sign, possibly screenable by blood test: Israel-US study
Many tumors are teeming with fungi that shed DNA into blood, and researchers say blood analysis could offer treasure trove of information to detect and to shape treatment
calls to her family that she didn't remember.
“My episodes were getting more and more bizarre ШВВВРА lives in Middletown, New York, told TODAY. “There were days that I
didn’t know where I was.”
a
cdc.gov/media/releases/2015/p1104-parasite-tumors.html
Hunting for fungus in the human body may offer a brand-new method for early detection of cancer, Israeli scientists suggest in new peer-reviewed research.
Scientists at the Centers for Disease Control and Prevention have discovered cancer cells originating in a common tapeworm may
take root in people with weakened immune systems, causing cancer-like tumors. It is the first known case of a person becoming
Working with colleagues in the US, they studied tumors from 17,000 cancer patients to document, for the first time, which fungi live in the tissue.
ill from cancer cells that arose in a parasite - in this case, Hymenolepis nana, the dwarf tapeworm.
There has been very limited research until now on fungi in tumors, and scientists had assumed that its occurrence was rare. "We were surprised to find that it's actually more common to find tumors with fungi than
without,” said Dr. Ilana Livyatan of the Weizmann Institute of Science.
The report, in the Nov. 5 issue of the New England Journal of Medicine, raises concern that other similar cases, if they occur, may
be misdiagnosed as human cancer - especially in less developed countries where this tapeworm and immune-system-suppressing illnesses like HIV are widespread.
"We were amazed when we found this new type of disease - tapeworms growing inside a person essentially getting cancer that spreads to the person, causing tumors," said Atis Muehlenbachs, M.D., Ph.D., staff pathologist in CDC's Infectious Diseases Pathology Branch (IDPB) and lead author of the study. "We think this type of event is rare. However, this tapeworm is found worldwide and millions of people globally suffer from conditions like HIV that weaken their immune system. So there may be more cases that are unrecognized. It's definitely an area that deserves more study."
Is it statistically significant that 100% of lung cancer patients are associated with parasites?
Ш ncbi.nim.nih.gov/pmc/articles/PMC6536861/
Jaroslav Bajnok,! Muyassar Tarabulsi,! Helen Carlin, Kevin Bown,’ Thomas Southworth,? Josiah Dungwa,? Dave Singh,? Zhao-Rong Lun,'3 Lucy Smyth, and Geoff Ніде!
к Author information > Article notes > Copyright and License information Disclaimer
Methods
Lung tissue samples were taken from patients undergoing lung resection surgery (n=72) for suspected lung cancer (infection prevalence 100% (95% CI: 93.9-100%)). All 72 participants were confirmed as having lung cancer following subsequent diagnostic tests. In addition, bronchial biopsy samples were collected from non-lung cancer healthy control subjects (n=10). Samples were tested for T. gondii using PCR amplification of T. gondii specific gene markers and T. gondii specific immunohistochemistry.
Results
EPA ee lem oem oases! with T. gondii (prevalence 100% (95% CI: 93.9-100%)). Of
which, 95.8% (n=69) of patients showed evidence of active parasite stages. Infection prevalence in the controls (10%) was significantly lower (p<0.0001).
@ cancer.org/healthy/cancer-causes/infectious-agents/infections-that-can-lead-to-cancer/parasites.html
Parasites that Can Lead to Пр Cancer
Certain parasitic worms that can live inside the human body can also raise the risk of developing some kinds of cancer. These organisms are not found in the United States, but
they can be a concern for people who live in or travel to other parts of the world.
Opisthorchis viverrini and Clonorchis sinensis are liver flukes (a type of flatworm) that have been linked to increased risk of developing cancer of the bile ducts. The bile ducts are tubes
that connect the liver to the intestines. These infections come from eating raw or
undercooked freshwater fish. They occur mostly in East Asia and are rare in other parts of the
world. Fungi grow inside cancerous tumors, scientists discover
Schistosoma haematobium is a parasite found in the water of some countries in the Middle © Live Science - 5h Q East, Africa, and Asia. Infection with this parasite (an illness called schistosomiasis) has been
linked to bladder cancer. Possible links to other types of cancer are now being studied as well.
If parasites cause cancer, would anti-parasite medications be effective against cancer? LINK
ё pubmed.ncbi.nlm.nih.gov/31375107/
Ivermectin inhibits canine mammary tumor growth by regulating cell cycle progression and WNT signaling
1 2
Hongxiu Diao ', Nan Cheng |, Ying Zhao 1, Huihao Хи ', Haodi Dong ', Douglas Н Thamm
Di Zhang 3, Degui Lin 4
Affiliations + expand PMID: 31375107 PMCID: PMC6679554 DOI: 10.1186/512917-019-2026-2 Free PMC article
Abstract
Background: Mammary gland tumor is the most common spontaneous tumor in intact female dogs, and its poor prognosis remains a clinical challenge. Ivermectin, a well-known anti-parasitic agent, has been implicated as a potential anticancer agent in various types of human cancer. However, there are no reports evaluating the antitumor effects of ivermectin in canine mammary tumor. Here, we investigated whether ivermectin was able to inhibit canine mammary tumor development and explored the related mechanisms.
Results: Ivermectin inhibited the growth of canine mammary tumor cell lines іп a dose- and time- dependent manner. The antitumor effects induced by ivermectin were associated with cell cycle arrest at G1 phase via down-regulation of CDK4 and cyclin D1 expression, with no significant induction of apoptosis. Furthermore, significantly reduced B-catenin nuclear translocation was observed after treatment with ivermectin, resulting in the inactivation of WNT signaling. Consistent with the results in vitro, a significant suppression of tumor growth by ivermectin was observed in canine mammary tumor xenografts.
Conclusion: Ivermectin, as a promising anti-cancer agent, inhibits the growth of canine mammary
tumor by regulating cell cycle progression and WNT signaling. The Benzimidazole-Based Anthelmintic Parbendazole: A Repurposed Drug Candidate That Synergizes with Gemcitabine in Pancreatic Cancer
/?022c 28386
ё pubmed.ncbi.nlm.nih.gov/ 621/ Rosalba Florio !, Serena Veschi 1, Viviana di Giacomo 1, Sara Pagotto 2,35 Simone Carradori 1"), Fabio Verginelli 132 Roberto Cirilli *, Adriano Casulli 56, Antonino Grassadonia 22, > Mol Med. 2017 Арг;23:50-56. doi: 10.2119/molmed.2017.00011. Epub 2017 Apr 5. Nicola Tinari 23, Amelia Cataldi 1, Rosa Amoroso 1Ф, Alessandro Cama 1/3" апа Laura De Lellis 1 1 Department of Pharmacy 'Annunzio University of Chieti-Pescara, 66100 Chieti, Italy; rosalba.florio@unich.it (R.F.); veschi@unich.it ( iana.digiacomo@unich. it (V.d.G.);
Repurposing Mebendazole as a Replacement for Vincristine for the Treatment of Brain Tumors e cement sis amelia.cataldi&unich.it (A.C.); rosa.amoroso&unich.it (R.A.);
Department of Medical, Oral and Biotechnological Sciences, G. d' Annunzio University of Chieti-Pescara, 66100 Chieti, Italy; sara.pagotto@unich .it (S.P); antonino.grassadonia@unich it (A.G.); nicola.tinari@unich.it (N.T.) Center for Advanced Studies and Technology (CAST), University “С. d'Annunzio" of Chieti-Pescara, 66100 Chieti, Italy Centro nazionale per il controllo e la valutazione dei farmaci, Istituto Superiore di Sanità, 00161 Rome, Italy; К roberto.cirilli@iss.it Affiliations + expand 5 WHO Collaborating Centre for the Epidemiology, Detection and Control of Cystic and Alveolar PMID: 28386621 PMCID: PMC5403762 DOI: 10.2119/molmed.2017.00011 Echinococcosis fn Animals and Humans), Istituto Superiore di Sanità (ISS), 00161 Rome, Italy; adriano.casulli@iss.it Free PMC article European Union Reference Laboratory for Parasites, Istituto Superiore di Sanità (ISS), 00161 Rome, Italy Correspondence: simone.carradori@uni alessandro.cama@unich.it (A.C.); Tel.: +39-0871-3554583 (5.С.); +39-0871- 559 (А.С.)
1, Caitlin Powell '
154
Michelle De Witt 1, Alexander Gamble 2, Derek Hanson 2, Daniel Markowitz Saleh Al Dimassi 1, Mark Atlas 3 4, John Boockvar 1 2 ^, Rosamaria Ruggieri
24
Marc Symons ! 2
Abstract Received: 26 November 2019; Accepted: 14 December 2019; Published: 17 December 2019 е, лы
The microtubule inhibitor vincristine is currently used to treat a variety of brain tumors, including low- grade glioma and anaplastic oligodendroglioma. Vincristine, however, does not penetrate well into brain tumor tissue, and moreover, it displays dose-limiting toxicities, including peripheral neuropathy. Mebendazole, a Food and Drug Administration-approved anthelmintic drug with a favorable safety profile, has recently been shown to display strong therapeutic efficacy in animal models of both glioma and medulloblastoma. Importantly, appropriate formulations of mebendazole yield therapeutically effective concentrations in the brain. Mebendazole has been shown to inhibit microtubule formation, but it is not known whether its potency against tumor cells is mediated by this inhibitory effect. To investigate this, we examined the effects of mebendazole on GL261 glioblastoma cell viability, microtubule polymerization and metaphase arrest, and found that the effective concentrations to inhibit these functions are very similar. In addition, using mebendazole as a seed for the National Cancer Institute (NCI) COMPARE program revealed that the top-scoring drugs were highly enriched in microtubule-targeting drugs. Taken together, these results indicate that the cell toxicity of mebendazole is indeed caused by inhibiting microtubule formation. We also compared the therapeutic efficacy of mebendazole and vincristine against GL261 orthotopic tumors. We found that
mebendazole showed a significant increase in animal survival time, whereas vincristine, even at a dose
close to its maximum tolerated dose, failed to show any efficacy. In conclusion Т 3757177
upport the clinical use of mebendazole as a replacement for vincristine for the treatment of brain
Q & pubmed.ncbi.nlm.nih.gov/31181622/
Zuzana Mrkvová !, Stjepan Uldrijan 2 3 Antonio Pombinho *, Petr Bartůněk 5, Iva Slaninová 6
Affiliations + expand PMID: 31181622 PMCID: PMC6600429 DOI: 10.3390/molecules24112152 Free PMC article
Abstract
Tumor suppressor p53 is mutated in about 50% of cancers. Most malignant melanomas carry wild- type p53, but p53 activity is often inhibited due to overexpression of its negative regulators Mdm2 or MdmxX. We performed high throughput screening of 2448 compounds on A375 cells carrying p53 activity luciferase reporter construct to reveal compounds that promote p53 activity in melanoma. Albendazole and fenbendazole, two approved and commonly used benzimidazole anthelmintics, stimulated p53 activity and were selected for further studies. The protein levels of p53 and p21 increased upon the treatment with albendazole and fenbendazole, indicating activation of the p53- p21 pathway, while the levels of Mdm2 апа МатХ decreased in melanoma and breast cancer cells overexpressing these proteins. We also observed a reduction of cell viability and changes of cellular morphology corresponding to mitotic catastrophe, i.e.. G2/M cell cycle arrest of large multinucleated cells with disrupted microtubules. In summary, we established a new tool for testing the impact of small molecule compounds on the activity of p53 and used it to identify the action of benzimidazoles in melanoma cells. The drugs promoted the stability and transcriptional activity of wild-type p53 via downregulation of its negative regulators Mdm2 and МатХ in cells overexpressing these proteins. The results indicate the potential for repurposing the benzimidazole anthelmintics for the treatment of cancers overexpressing p53 negative regulators.
Pharmacol Res. 2021 Jan; 163: 105207. PMCID: PMC7505114 Published online 2020 Sep 21. doi: 10.1016/j.phrs.2020.105207 PMID: 32971268
Ivermectin, a potential anticancer drug derived from an antiparasitic drug
Mingyang Тапо,20.ї Xiaodong Hu, ^ Yi Wang, Xin Yao,24 Wei Zhang,2” Chenying Yu,2» Fuying Cheng,®> Jiangyan 11,24 and Qiang Fang? 4e"
Am J Cancer Res. 2018; 8(2): 317-331. PMCID: PMC5835698 Published online 2018 Feb 1. PMID: 29511601
The multitargeted drug ivermectin: from an antiparasitic agent to a repositioned cancer drug
Mandy Juarez, Alejandro Schcolnik-Cabrera,' and Alfonso Duefias-Gonzalez?
Ivermectin converts cold tumors hot and synergizes with immune checkpoint blockade for treatment of breast cancer
Dobrin Draganov, Zhen Han, Aamir Rana, Nitasha Bennett, Darrell J. Irvine & Peter P. Lee
npj Breast Cancer 7, Article number: 22 (2021) | Cite this article
Why are anti-parasitic purgatives such as Ayuahuasca or San Pendro effective against cancer and depression? Do parasites cause depression?
Do parasites cause cancer?
What would happen to the symptoms if the cause is removed?
75
by Max Roser and Hannah Ritchie
This article was first published in July 2015; updated in April 2018 with latest cancer data for the year 2017 - and revised
substantially in November 2019.
© Reuse ourworkfreely Cite this research
In 2017, 9.6 million people are estimated to have died from the various forms of cancer. Every sixth death іп the world is due to cancer, making it the second leading cause of death - second only to cardiovascular diseases.*
Cancer is the second leading cause of death in the world. What is the first?
Are certain cardiovascular diseases caused by parasites? What is Dirofilaria immitis?
-Heart Disease 23% of total deaths -Cancer = 21% of total deaths
Both causes draw direct links to parasites.
Yet there is still no regular schedule for parasite treatment in humans. No treatment, despite links to 44% of total deaths world-wide.
70,000 deaths EVERY DAY can be linked to parasites.
Still no treatment schedule.
More deaths every day than American soldiers died during the entire Vietnam War. Still no treatment schedule.
If 70,000 lives could be saved every day with a $1/day parasite treatment, would the entire world be placed onto a parasite-treatment schedule?
What if 99% of the world population was infected?
What if people discovered the information in this document?
Would the truth put 99% of people in the hospital? [142]
What effect would world-wide routine parasite treatments have? [Host no longer transfers power to (((Handlers)))]
[Voters no longer easily swayed by Mass-media assets]
What would happen to (((their))) system of control?
[Maintain control by any means necessary]
What happens to those who discover evidence of this?
76
The world's top anti-virus microbiologists are being killed off. By 2005, 40 were dead. Today, over 100. Many murdered, the rest died under very suspicious circumstances. It is known they were all working on highly sensitive or government-funded research projects tied to bio-weapons and viral pandemics.
Why do doctors who discover the link between parasites and cancer always commit suicide? LINK
[Maintain control by any means necessary]
77
а, о
А world of viruses nested within parasites: Unraveling viral diversity within parasitic flatworms
(Platyhelminthes)
West Nile virusXartificially coloured) can invade the central nervous system more easily in
the-presence of parasitic worms. Credit: Science VU, Visuals Unlimited/Science Photo
December 2021 DOI:10.1101/2021.12.15.472606
Abstract
Because parasites have an inextricable relationship with their host, they have the potential to serve as viral reservoirs or facilitate virus host-shifts. Yet, little is known about viruses infecting parasitic hosts except for blood-feeding arthropods that are well-known vectors of zoonotic viruses. Herein we uncover viruses of flatworms (Phylum Platyhelminthes, group Neodermata) that specialize in parasitizing vertebrates and their ancestral free-living relatives. We discovered 115 novel viral sequences, including 1 in Macrostomorpha, 5 in Polycladida, 44 in Tricladida, 1 in Monogenea, 15 in Cestoda and 49 in Trematoda, through data mining. The majority of newly identified viruses constitute novel families or genera. Phylogenetic analyses show that the virome of flatworms changed dramatically during the transition of Neodermatans to a parasitic lifestyle. Most Neodermatan viruses seem to co-diversify with their host , with the exception of rhabdoviruses which may switch host more often, based on phylogenetic relationships. Neodermatan rhabodviruses also have an ancestral position to vertebrate-associated viruses, including Lyssaviruses, suggesting that vertebrate rhabdoviruses emerged from a flatworm rhabdovirus in a parasitized host. This study reveals an extensive diversity of viruses in Platyhelminthes and highlights the need to evaluate the role of viral infection in flatworm-associated diseases.
Do parasites build viruses?
(You): B-But if Parasites cause the flu, where do Viruses come fro- The Parasite-Pill
Correspondingly, much attention has been paid to the “excretory-secretory” (ES) antigens of
helminths, a pragmatic approach to collect mixtures of released proteins that dates back over How PARASITES evade the 60 years [9]. Much more recently, of course, the application of genomics, transcriptomics and
mass spectrometry has transformed our understanding of these complex and heterogeneous | ттипе Syste m
preparations by defining the individual molecular components that parasites release to modify
their environment [2]. As discussed below, these products are not only proteins, but also
include glycans, lipids and nucleic acids, in particular miRNAs, as well as small molecules and
metabolites, and are released in a variety of “packages”, including lipid vesicles. — ee Қыл АН Шаң
- Genetic material Nucleic Acids v (ОМА ог RNA) miRNA wal
М Capsid — Protein [V] Typical Virus Makeup
<
Typically 50-250 nm in diameter ANY QU ESTIONS?
Link: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5008435/
Asexual reproduction in the intermediate host [ edit]
Tachyzoites: LINK
What are Exosomes? LINK
[cellular communication network]
Do parasites build viruses to hijack the host's communication network between cells?
By hijacking communications, can the parasite manipulate the host's cells into serving the parasite? LINK Do viruses cause disease, or do parasites cause viruses?
Does a cough transmit infectious viruses or does it transmit infectious parasites which then produce viruses? Are viruses a disease or a symptom?
Why are anti-parasite medications [really] considered to be anti-viral?
Do the anti-parasite medications cure the disease, and thereby also relieve the symptoms [viruses]?
What is Pleomorphism? LINK
Born out of healthy cells? ...Or unseen parasite larva hatching due to the newly created acidic environment?
79
22341287338
No, parasites use hormones and various other chemicals to alter the host behavior. They get into your body but they don't get into your DNA. m Anonymous (ID: 4GWMIESA») = 09/28/21(Tue)17:32:20 No.341304532 » >>341304963
22341303196
they use epigenetics, bro
Anonym (ID 8) = 09/28/21(Tue)17:35:35 No.341304963 >>341305834 File: BBF4CO5F- ТЕСВ4 AF15-8(...).jpg (192 KB, 1200x2029) >>341304532
>they use epigenetics, bro Interesting. How, exactly? You got any sauce?
CJ] Anonymous (ID: €GVAMIEBAD) == 09/28/21 (Tue)17:42:15 No.341305834 »
>>341304963 https://www.sciencedirect.com/science/article/abs/pii/S092544392 1001472
parasite pill makes too much sense.
Do parasites use viruses to manipulate a host’s DNA through epigenetics?
@ news-medical.net/news/20200825/Advances-in-Virus-Epigenetics.aspx
How can a virus use epigenetic cofactors to dysregulate cellular pathways and help control its life cycle?
There has been growing evidence that viruses exploit epigenetic processes in order to control their life cycles. The role epigenetics plays in the regulation of viral infections is not yet fully elucidated and the epigenetic regulation of viral gene expression has only recently begun to emerge. Epigenetic regulation during viral infections is usually bidirectional.
Virus will use host cellular factors for transcription or replication and epigenetic cofactors
For many virus types, nuclear persistence is dependent on genome chromatisation, where virus DNA associates with core histone proteins, forming episomes during latent infection. Integrating viruses such as retroviruses and lentiviruses insert their DNA into host genomes, facilitating histone associations so that the viral chromatin is then subject to histone modifications. This viral epigenome, like the host cell machinery, has significant impact on viral gene expression and replication.
80
Amaranta Gómez-Arreaza ! , Anne-Lise Haenni 2, Irene Dunia ?, Luisana Avilán 4
Affiliations 4- expand PMID: 27876650 DOI: 10.1016/J.actatropica.2016.11.028
Abstract
The complex parasite-host relationship involves multiple mechanisms. Moreover, parasites infected by viruses modify this relationship adding more complexity to the system that now comprises three partners. Viruses infecting parasites were described several decades ago. However, until recently little was known about the viruses involved and their impact on the resulting disease caused to the hosts. To clarify this situation, we have concentrated on parasitic diseases caused to humans and on how virus-infected parasites could alter the symptoms inflicted on the human host. It is clear that the effect caused to the human host depends on the virus and on the parasite it has infected. Consequently, the review is divided as follows: Viruses with a possible effect on the virulence of the parasite. This section reviews pertinent articles showing that infection of parasites by viruses might increase the detrimental effect of the tandem virus-parasite on the human host (hypervirulence) or decrease virulence of the parasite (hypovirulence). Parasites as vectors affecting the transmission of viruses, In some cases, the virus-infected parasite might facilitate the transfer of the virus to the human host. Parasites harboring viruses with unidentified effects on their host. In spite of recently renewed interest in parasites in connection with their viruses, there still remains a number of cases in which the effect of the virus of a given parasite on the human host remains ambiguous. The triangular relationship between the virus, the parasite and the host, and the modulation of the pathogenicity and virulence of the parasites by viruses should be taken into account in the rationale of fighting against parasites.
Once you understand that these "viruses" are fabricated mental constructs to explain away the actions of parasites to keep us chasing our tails, you'll understand that PARASITES are the mRNA editors. The longer they remain active in your system, the more likely you are to
One in a million (or whatever it is) of those mRNA edits fails to get deleted by your body's fail safe, RNA polymerase, which is theoretically supposed to catch mutations or gene damage to mRNA and delete them before they become DNA. With parasites, the mRNA edits are so frequent, that it becomes inevitable that some changes will make it past the gatekeeper. This is especially problematic for the vaccinated people. The number of edits they'll experience is in the billions,
nonymous (10. ) ШЕ 09/26/21 (Sun)17:00:46 Мо.341002 have a degree in microbiology. AIDS is casued by the CHAGAS parasite, trypanosoma Cruzi. HIV was a theoretical construct they used to hide the truth, never isolated based on computer modeling, with Anthony Fauci running cover-up while people like Nobel prize-winning Kary Mullis, who invented the PCR test, spent their career trying to expose Fauci's lies and blow the whistle on the AIDS scam only to be mysteriously murdered just before the launch of COVID, which is modified T. Cruzi. The particles they look at & call "viruses" are stress proteins created by a body that's either infected with parasites or exposed to toxins. They are exosomes, not viruses. It's merely the correlation fallacy. They're not causative. T. Cruzi causes AIDS in EVERY animal. Of course they call it immune dysfunction, immunopathology, etc Chagas causes macrophage derangement -https://pubmed.ncbi.nlm.nih.gov/9464791 T. Cruzi causes autoimmune disease that causes heart disease https;//pubmed.ncbi.nlm.nih gov/25521296/ https://pubmed ncbi.nim.nih.gov/21734249/ Chagas and auto-immunity https://pubmed ncbi.nlm.nih.gov/22951533/ Chagas causes auto-immunity in chickens https://pubmed ncbi.nlm.nih.gov/16323421/ Chagas causes immune dysfunction by mimicking other toxins/pathogens (& carrying heavy metals on it's surface) to fool your immune system https:/Awww.ncbi.nim.nih.gov/pmc/articles/PMC5823355/ All parasites are https://pubmed ncbi.nim.nih.gov/29211102/ Sexual transmission of Chagas is an ordinary eve
https:/www.longdom.org/open-access/trypanosoma-cruzi-and-domestic-animals-2327-5073-1000e142 pdf 100 million people are exposed yearly in Latin America, alone, making it the MOSt prevalent STD in the world.
nonymous (ID ) ЕН 09/26/21(Sun)17:05:39 Мо.341003512 жисіе Г ona (21 KB, 720x198)
All the species of trypanosoma are given different names based on the host they аге found in. But every species is cross contagious with every other host. IE, if you take the chicken version and put itin a human, it will follow the same life cycle as if it сате from a shellfish or cow. The indestructible eggs (oocys з identical in every species, along with the larval form otes. The adult form chang nding on the host, like the alien face hugger changing slightly depending on it's host. They call the disease v Dourine in horses. In reality, it's all the same species, structurally and morphologically identical. It's a multi-trillion dollar cover-up that allows Big AG is Broad resistant callie hel wort ie o окота cl бекті
KNOW: https://link springer com/chapter/10.1007/978-94-011-9034-3_ 36
Anonymous (ID: ) /26/21 )17:02:42 3 3112 »
Рап 2
Т. Cruzi is EVERYWHERE, іп ай mammals, birds, & shellfish, found in 80% of randomly tested guinea pigs https:/www.ncbi.nim.nih.gov/pmc/articles/PMC46: raccoons, 77% of Argenti ats https-//pubmed.ncbi.nIm.nih.gov/3237 1222)
40% of wild pigs, 44% of Italian bats, 80% of chickens. It's the #1 cause of heart failure- І found in this МІН. ed article that | had to use the WayBack Machine to locate https://www.researchgate.net/publication/326591340 Prevention and Control of
An Overview
Mosquitos, triatome beetles, ticks, fleas, biting flies, are all vectors, but by my estimation account for less than 10% of the spread. Most outbreaks are linked to contaminated food https;//www.elsevier.es/en-revista-medicina-clinica-english-edition—462-articulo-orally. transmitted-chagas-disease-S2387020617300992 and contaminated beverages https://pubmed.ncbi.nim.nih.gov/32781335/ & then sexual transmission is right up there.
This is the most versatile pathogen every to exist, yet the official dogmatic narrative is that it's rare, non sexually transmitted, (despite being found in the semen of every animal tested) and only spread by a single beetle. Nothing to see here. The plot thickens
inonymous (ID: ) EB 09/26/21(Sun)17:06:52 No.341003675 >
Part 4
Pretending all our problems are caused by secondary infections of viruses and bacteria instead of parasites allows Big Pharma to generate trillions by treating the second symptoms of infection that arise with immuno-compromise. Most people will live with it for 50+ years and never get rid of it. It doesn't kill you. It just weakens you & when you get old and weak it causes secondary infections that kill you. 90% of tests will yield false negatives, so it's VERY difficult to detect. Most cases are identified post mortum by autoopsy. Or by biopsy of lymph nodes, which only shows positive if you are in stage 3 of infeciton. This problem is compounded by the fact that doctors are trained to believe that it's exceedingly rare, and they'll try to steer you away from parasites if you bring it up, owing to their demonic Rockefeller indoctrination combined with their narcissistic personality profiles, which are a prereq for acceptance into the medical programs. The boards all know, as do the people who write the textbooks. All the books have been written for the express purpose of covering this up, along with the role that other parasites play, causing 60-80% of human health problems. Why would every government agency deny it's sexual transmissivity? Why haven't they done tests on US cattle to determine the prevalence on farms? Why do they continue to gaslight us and pretend that a beetle is the only vectors, a beetle which probably accounts for less than 1% of the spread?
inonymous (ID: ) EB 09/26/21(Sun)17:08:21 Мо.341003849 »
Part 5: How do | know CO uzi? Covid strips iron off hemoglobin, much like the parasite malaria. This is a very complex task that requires the production of enzymes to digest the alpha chains, enzymes are larger and mort mplex than a virus. The virus is analagous to a knife. The enzyme inalogous to a bomb. A parasite is analogous to a factory. A virus would have no reason or ability to do this. Parasites like Chagas, on the other hand, are known to strip iron to use iron to hyper accelerate their growth. Both Сома and Chagas cause macorphage confusion, CD4 dysfui on, and the re: 5 endocarditis as the macrophages target the ACI ptors of € that have 51 spike 5 in them (a problem made much worse with the vaccine). Coronavirus and HIV are the ONLY pathogens that contain s1 spike protein, a 4 letter 2quence patented by F г (which has 70 CCP members on the board) in 1 t ence. The the same base thing, though COVID has been gain of functioned SIGNIFICANTLY. Covid long-haul syndrome 15 extremely similar to the AIDS progression. It's uncanny. The reason ADE reactions occur is that the anti-viral antibodies that you body produces post vaccine don't stick to parasites, so they end up circulating and causing acidic damage to every organ instead. The CV19 version s s able to survive on dry surfaces for days instead of minutes, a major change, but otherwise it's pretty much the same progression
nonymous (10. ) ЕН 09/26/21(Sun)17:09:39 No.341004008 » Part 6:
So after | figured this all out, the biggest cove-up of all time; that parasites are the main plague we face, | went searching on the chans to see if anyone else had realized it, and | found the mother of all red pills, the thing that Q has been prepping us to accept. The final lesson. You aren't ready for this unless you've already accepted that 1) The media is a coordinated lying campaign 2) The 3 letter agencies are evil gatekeepers 3) The western medical establishment cares nothing for human life 4) There is a systemic attempt to destroy society & freedom оп a global scale by collectivist ideologies 5) The elites are blood drinking child raping monsters pushing degeneracy on the population for a sinister purpose. Behold, the answer the all the riddles: THE РАКА:
Dr. Fauci claimed that , mig e í by “routine clos contact.’ (May 5, 198
Association). (Mich What could possibly go wrong:
l'oronto pop-upis the first of its kind anywhere, and was born out of a recent poll suggesting many still fear sharing food with someone HIV positive
We all have tapeworm stages in our bodies, probably going back to childhood when we ate dirt. It is not normal for these stages to hatch and develop further. Their purpose is to stay dormant. And perhaps they do little harm this way.
But I have found that all HIV/AIDS sufferers have "tapeworm disease". The stages are hatching. This spews the tiny larvae and cysts, plus unfertilized eggs and their bacteria all over the body, making you feel sick. Perhaps the large amounts of solvents accumulated in the body forces them to hatch; perhaps the lowered immunity allows them to hatch.
Jonathan Couey Fernando Castro-Chavez Johanna Deinert Angus Dalgleish
Simon Wain-Hobson Richard Fleming
Kevin McCairn Luc Montagnier Rossana Segreto Jean-Claude Perez
Ah Khan Syed [pseud] Steven Quay
Jack Ward [pseud] Birger Sorenson
Dayou Zhang
My findings and conclusions on scientific censorship are based on several thousand hours of individual research. The findings related to the HIV inserts in general, gp120, the furin cleavage site and other aspects of the SARS-CoV-2 genome are the product of those listed above, or others referenced in the endnotes.
The implications are profound, and profoundly disturbing; the scale of the response to the first draft and livestream has clearly shown me that my intuition about their importance was correct. I’ve published them here, now, because the evidence has become so overwhelming that I can’t, in good conscience, withhold these conclusions from the public. In short:
Dr. Fauci & others knew, based upon the suspicious elements of the SARS-CoV-2 genome, that the virus had almost certainly been manipulated
They knew that such manipulations likely came from pseudovirus & insertion techniques very familiar to US & Chinese viral vaccine & therapeutic/ МСМ programs
They immediately took steps to censor and control public & scientific discussions related to the HIV inserts and FCS, respectively; these actions are more properly viewed as obstruction of justice
This had major implications for both the early response to the pandemic [FCS] and the long-term impact on global public health [the HIV inserts and ‘Long COVID' sequelae]
Without hesitation, 1 would testify under oath to the veracity of the evidence in support of these conclusions. They involve implications that are horrific regardless of which scientists, from which country, may have been responsible for creating SARS-CoV-2. I propose the list of questions that follows on behalf of the victims of the COVID-19 pandemic, who cannot ask them themselves. I promise you, however, that all of them are waiting to hear the answers.
Semper Fidelis.
A
Charles H. Rixey
HIV >>> t.cruzi Is Covid19 an airborne parasite [bioweapon]?
83
CDS:surface glycopro 65 N H5 Y EG DI P IG A 6 CASS v OT Query MET CEA FTGGTSCAGGTATATGCGE TAGTTATCAGACT | | | LiL Sbjct ACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTC CDS:surface glycopro NW SY E € 0 T P IG AG IC AS V9 T CDS:surface glycopro ЖР У А 5 QS І ТА ҮТ Query TH THERE EET HIT TTT Mitt yt TTGCCTACACTA | | | 005 | | | Sbjct LDA CREE Gate AC AGIGTAGCTAGTCAATCCATCATTGCCTACACTA CDS:surface glycopro Д Q NaSi P- RGR A EVA SQSIIAYT
CDS:surface glycopro MS LGAENS VAY S NN TA DP T
Query TGTCACTTGGTGCAGAAAATTEAGTTGCTTACTCTABTAACTCTATTGCCATACCCACAA | | Ш | |
Sbjct TGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAA
CDS:surface glycopro M LG A E NS VÀ X SH OAS: TA IP Т
CDS:surface glycopro 717 D 5 WT Е Be VS. БОЛ Т.М Query 237 ТОНИНИ ШІ ШІ ТІН | | | Sbjct 237 ATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAG CDS:surface glycopro 717 N D m wy E #5 MTkKkT1Swv
Now, this is really interesting because not only have we seen that the QTNS section is derived
furin cleavage site and as we have seen, these don't exist in this type of SARS-like virus. It's an insertion to the viral genome, but nobody really knows how it got there (just like the HIV
sequences). In order to see where it came from we need to look outside the amino acid
It's easy enough to change a single nucleotide (a single point mutation or SNP) or even insert or delete nucleotides (less common) but to insert 20 or 30 nucleotides with a code that works?
Nope, that has to come from another virus or else it's been done in a lab.
So, where did this code come from? Well it turns out that BLAST can tell us - with some degree of certainty - where some of this code, particularly the bit that codes for the PRRAR
section (the furin cleavage site which is so unique), came from.
The bit that we are interested in is in the clue from Jikky. CTCCTCGGCGGGCACGTAG.
What you see is the same (misclassified SARS-CoV-2) sequences in the first 9 hits, and then none of the remaining hits have 19/19 matches. What this means is that there is no virus known to man that has this particular sequence in its genome prior to the discovery of
SARS-Cov-2. So where on earth has it come from?
Yes, that's right. Every single one of these patents that contains that 19nt sequence (for which
the probability of occurring by random chance is less than 1 in a billion) is from Moderna. In order for that sequence to have arisen in that virus, the virus which was manufactured
with its HIV inserts, had to have had been infected into patented cell lines supplied by
Moderna that had that unique sequence not seen in any other virus.
In theory nothing is impossible in science, medicine or genomics. A SARS virus emerging naturally with 3 HIV inserts at its binding sites and also containing a furin cleavage site that doesn't exist in nature but does exist in a Moderna patent... that's seriously crazy talk. It
doesn't exist. A flying pink elephant would be a million times more likely.
Has anyone started looking into the Parasite angle for the Corona Virus?. Where the "virus" symptoms are just a result of the parasite(s) infesting the hosts?.
Very surprised no one has been considering it.
Do some lose their sense of smell when they catch Covid?
Do some suffer tinnitus when they catch Covid?
Can you lose your sense of smell or get tinnitus from nerve damage?
Are there nerves from your ears and nose directly connected to your brain?
Do parasites seeking the brain utilize the neutral pathways of the nose and ear to access the brain?
Blood-brain barrier and retroviral infections
Florence Miller, - t- $ Philippe V. Afonso, 2:2 · $: + Antoine Gessain, 2:3 and Pierre-Emmanuel Ceccaldi? 3-4
» Author information + Copyright and License information Disclaimer
This article has been cited by other articles in PMC.
Abstract Go to: »
Homeostasis in the central nervous system (CNS) is maintained by active interfaces between the
homeostasis. Retroviruses have been associated to human neurological diseases: HIV (human immunodeficiency virus 1) can induce HIV-associated dementia, and HTLV-1 (human T lymphotropic virus 1) is the etiological factor of tropical spastic paraparesis/HTLV-1 associated myelopathy (TSP/HAM). The present review focuses on how the different retroviruses interact with this structure, bypass it and alter its functions.
Is lvermectin effective against Covid-19?
Why does Ivermectin lose effectiveness after 3 days of Covid-19 infection?
Could the Covid [Parasite] gain access to the brain in 3 days by utilizing neural pathways? Does Ivermectin bypass the blood-brain barrier? [N]
Is Covid19 a biological weapon caused by a parasite? Accidentally released or intentionally?
If intentional, what for what purpose?
Is drinking snake venom relatively harmless?
What if you inject snake venom?
Reconcile.
Are airborne pathogens difficult to contain? Are injectable pathogens easy to contain? Reconcile.
Was the relatively harmless airborne parasite used to create demand for the injectable one? Which is the [real] bioweapon?
85
UNCLASSIFIED
DEFENSE ADVANCED RESEARCH PROJECTS AGENCY 675 NORTH RANDOLPH STREET ARLINGTON, VA 22203-2114
13 Aug 21
From: COMMANDANT OF THE MARINE CORPS FELLOW, DARPA To: INSPECTOR GENERAL
Subj: SARS-CoV-2 ORIGINS INVESTIGATION WITH US GOVERNMENT PROGRAM UNDISCLOSED DOCUMENT ANALYSIS
Ref:(1) Executive Slide НВ0011850017 EcoHealth Alliance DEFUSE
(2) HROO118S0017-PREEMPT-FP-019-PM Summary (Selectable - Not Recommended)
(3) PREEMPT Volume 1 no ESS HR0011850017 EcoHealth Alliance DEFUSE
(4) PREEMPT Volume 2 EHA Final HR0011850017 EcoHealth Alliance DEFUSE
(5) SF424 2 0-V2.0 HR00118S0017 EcoHealth Alliance DEFUSE
(6) WIV Budget packet HR001118S0017 EcoHealth Alliance DEFUSE
(7) WS00094394-RR KeyPersonExpanded 2 0-У2.0 HR00111850017 EcoHealth Alliance DEFUSE
(8) WS00094394-RR PersonalData 1 2-V1.2 HROO1118S0017 EcoHealth Alliance DEFUSE
1. SARS-CoV-2 is an American-created recombinant bat vaccine, or its precursor virus. It was created by an EcoHealth Alliance program at the Wuhan Institute of Virology (WIV), as suggested by the reporting surrounding the lab leak hypothesis. The details of this program have been concealed since the pandemic began. These details can be found in the EcoHealth Alliance proposal response to the DARPA! PREEMPT? program Broad Agency Announcement (BAA) НК0011850017, dated March 2018“! - a document not yet publicly disclosed.
The contents of the proposed program are extremely detailed. Peter Daszak lays out step-by-step what the organization intends to do by phase and by location. The primary scientists involved, their roles, and their institutions are indicated. The funding plan for the WIV work is its own document. The reasons why nonpharmaceutical interventions like masks and medical countermeasures like the mRNA vaccines do not work well can be extrapolated from the details. The reasons why the early treatment protocols work as curatives are apparent.
SARS-CoV-2's form as it emerged is likely as a precursor, deliberately virulent, humanized recombinant SARSr-CoV that was to be reverse
What did Colonel Vladimir Kvachkov mean by this:
Can you give us any predictions for the nearest future?
In connection to the Coronavirus?
Yes.
What do you think, which countries could expect pressure next? Russia of course! It's going to be Russia surely. Because for America, Russia isn't an economic competitor. Now the main efforts of the behind-the-scenes world powers are focused on causing disruption in China and Western Europe. And Russia is their target on two accounts: they want to reduce our population numbers and to “cleanse” the territory. That is still to come.
Of course, we would like to hear your opinion regarding a practical plan of action, how to act, how to protect oneself, some recommendations. Maybe it's not your field of expertise but maybe you could tell us something.
Are There Parasites in the Pfizer "Vaccines"?
{у Dr. Robert О. Young |ng Media Events Case Studies. Contact Scientific Posts Blog
Oa COST Nt OAA AA E E Scanning & Transmission Electron Microscopy Reveals Graphene & Parasites in CoV-19 Vaccines
February 5th, 2021 - Updated October 1st, 2021 & March 12th, 2022!
Author: Robert
[Figure 13 shows a Trypanosoma Parasite approximately 20 microns in length found in the so- called Pfizer “vaccine”. It is composed of carbon, oxygen chromium, sulphur, aluminum, chloride and nitrogen.]
https://archive.ph/R16RP
Do the vaccinated suffer blood clots?
Does venom cause blood clotting?
He was correct about the venom: LINK
But wrong about the water.
From where does the venom actually come?
& pubmed.ncbi.nlm.nih.gov/31030034/ Phase Contrast, Dark Field, Bright Field Microscopy, Transmission and Scanning Electron Microscopy and Energy- Review. > Thromb Res. 2019 Jun:178:145-154. doi: 10.1016/;.thromres 201: Dispersive X-ray Spectroscopy Reveal the Poisonous
Ep
Modulation of the mammalian coagulation system by venoms and other proteins from snakes, arthropods, ‘nematodes and insects
AT A Sachetto *, М Mackman
Affiliations + expan Parasites found on sterile Covid-19
PMID: 31030034 DOI: 10,1016/j.thromres.2019.04.019 testing swabs: LINK Abstract
The mammalian hemostatic system involves complex interactions between protein components of the coagulation cascade and platelets. The fibrinolytic system removes the hemostatic plug. Dysregulation of coagulation or fibrinolyt tems can induce bleeding or thrombosis. Animals, such as snakes, worms and ir fe evolv express proteins that modulate the mammalian coagulation and fibrinolytic systems. Many of these proteins have been isolated and characterized. Understanding the
mechanisms by which these exogenous factors from venoms and animal saliva modulate the
drugs. This review summ 5 our current knowledge of exogenous prote от venom and saliva
that either activate or inhibit the mammalian coagulation and fibrinolytic systems Anonymous (10: @axxaya®) [+l 09/22/22(Thu)07-28:39 Мо.396424770 » >>396425055
Evidence of permanent genetic alteration:
https://www.mdpi.com/1467-3045/44/3/73/html
>Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line https-//pubmed.ncbi.nlm.nih.gov/36054264/
>Pre-exposure to mRNA-LNP inhibits adaptive immune responses and alters innate immune fitness in an inheritable fashion
That last one comes to a conclusion that could have... implications... for the human species as we know it. Or knew it, depending on how bad...
22396424770 >Interestingly, mice pre-exposed to the mRNA-LNP platform can pass down the acquired immune traits to their offspring
If this sentence didn't fill you with a sinking sense of foreboding and dread, you didn't fully grasp its implications. Think... ТЕТІ Baked into the genome. Inheritable from parent to child.
Do the “elites” who control the world fear losing control? Do the “elites” of the world use parasites to maintain their control? Do the “elites” of the world cover up science in order to protect these parasites which grant them control?
Conclusion: Humans are intentionally infected with parasites. Those parasites work their way into the human brain or gut where they begin influencing the behavior of their hosts. Certain parasites are used to kill enemies of the elites. Other parasites are capable of completely taking control over the host. The host is then used to infiltrate human society where the parasite works to change that society in such a fashion as to make it easier for the parasites to spread within that society. [parasite paradise]
But are the elites of the world the [real] enemy? Or are they actually controlled hosts, themselves?
Anthrax
What is the Formic Fleet? Truth disguised as fiction?
consisted of Hive Queens, male drones, and workers." The
workers did not concern them.
Who are the Workers? Who are the Drones? Who is the Hive Mind?
6. THE WORKERS
Who are the workers? Which group of people acts as one collective whole? What is nepotism?
Does this group often claim to belong to the ‘collective’?
(((Who))) [really] controls the media?
Isra elSrever ABOUT US + PROGRAMS ~ EXPLORE ISRAEL + E [ n h
PFA TAS A. Lx 4 4 ) ана ЕН `4
AN ATTACK ON ONE JEWISH COMMUNITY IS AN ATTACK ON ALL JEWISH COMMUNITIES
rector Most о
RAT
| пирин ERACE "lel MORE IP EIRC Tar "BER TRA
If Jews represent just 2% of the U.S. population, would it be odd for a media
It's almost as if...
89
Which group of people acts as thick as thieves?
thick as thieves idiom Q save Word
Definition of thick as thieves
COMCAST 4" NBCUNIVERSAL “ NBCUniversal News Grr
Й!
Ст & СЕО Comcast Se Exec. VP, Comeast
: very close and secretive
/
National Poltical Orector. ср Legal Corresponde.
Host of Meet the Press Host of The Beat АЛМ Ma "ot An Meter
Present. == Planning President Universal TV — President, Research 1 Meda " 6 с " Preside MBCUniversal President, Programming President, Operations & strane UC n Aion] АЛ. Studio (NBC Televison) ) C Cu (ВСга Vet) Studios (NBC Fant (NBCSpert & NBCSN) Strategen [NEC Sport Meet Atv Қат есі Sock at darn Mier меу / сей
Sa VP, News Speciale & Transformation (NBC)
Nighy несе Wend а Souto ӘС ipit Се
атан
It almost seems like...
90
(((Who))) [really] controls the media?
Р, Lead Editor, Editorial Page President & GM, NYT's The net
James Ben Wirecutters. Dand Perpich
Aden Coen
с
09-24 Coronas Rayer Секе wd Ponts kay Y
о-уеггер-ге-зепі [over repre zent] %)
VERB include a disproportionately large number of (a particular category or type of person),
Manging Editor Joseph Kahn
ы? Deputy Publisher Deputy Manging Editor Senior VP, NYT Global Arthur Gregg Sulzbeeger Rebecca Blumenstem Paul Walborsky
Berlin Bureau Chie! Саон Europe Bureau САТ South Asia Bureau Chief Australia Bureau Chet Amen Sree ick Lye ебу Се есен Damen Caw
Chiat White House Correspondent Y Baher
If roughly 2% of Americans аге Jews, is it odd that а newspaper’s Chairman & Vice Chairman, Publisher & Deputy Publisher, Managing Editor & Deputy Managing Editor, President & CEO’s spouse, Chief Operating Officer, and majority of its Directors and Exec. Committee are Jewish? What if its D.C., L.A., London, Paris, Rome, Berlin, Central/East Europe, South Asia, and Australia Bureau Chiefs, its Editor-in-Chief of its Editorial Page and Global, Magazine, and Business Editions, and its Chief National, International, Political, Domestic Affairs, Military, and White House Correspondents—all but one *Chief" Correspondent—are also Jewish?
nep:o-tism
[nepe tizem] %)
NOUN
the practice among those with power or influence of favoring relatives or friends, especially by giving them jobs:
XX Jewish Chair of the NPR Foundation Senice Vice President of News and Editorial Director
Howard Wollner Michael Oreskes
Fan Cubic, famh Ae Geoffrey Nunberg Yerchok Edeistein
"A. X ) Б> g i ~ Сн Cachan ро hentay Andy Borowtz
M e iren,
a Flatow
а Liat
About 20% of US taxpayer funded NPR's personnel are of Jewish descent.
It gets worse.
92
Who controls Wall Street? Of the 51 senior executives on Wall Street, 37 are jews or have jewish spouses.
(jewish overrepresentation of 3,250%
Who controls Big Media? Of the 12 senior executives of the “Big 6” media corporations, 9 are jews or have jewish spouses.
(jewish overrepresentation of 3,750%)
Who controls Hollywood? Of the 60 senior executives of the major Hollywood studios, 50 are jews or have jewish spouses.
(jewish overrepresentation of 4,150%)
Who controls Television? Of the 64 senior executives of the major television broadcast networks, 57 are jews or have jewish spouses.
(jewish overrepresentation of 4,450%)
Who controls Music? Of the 50 senior executives of the major music labels, 39 are jews or have jewish spouses.
(jewish overrepresentation of 3,900%
Who controls Radio? Of the 46 senior executives of the major radio broadcast net- works, 28 are jews or have jewish spouses.
(jewish overrepresentation of 3,050%)
Who controls Advertising? Of the 46 senior executives of the major advertising corpora- tions, 31 are jews or have jewish spouses.
(jewish overrepresentation of 3,360%)
Who controls the News? Of the 67 senior executives of the television and radio news networks, 47 are jews or have jewish spouses.
(jewish overrepresentation of 3,500%)
Who controls Newspapers?
Of the 65 senior executives of the major newspapers and
news magazines, 42 are jews or have jewish spouses. (jewish overrepresentation of 3,250%)
Who controls E-bay? Of the 9 E-bay executives, 6 are jews or have jewish spouses. (jewish overrepresentation of 3,350%)
Who controls Apple? Of the 10 Apple executives, 3 are Jews or have jewish spouses. (jewish overrepresentation of 1,500%)
Who controls Yahoo? Of the 13 Yahoo executives, 8 are jews or have jewish spouses. (jewish overrepresentation of 3,100%)
Who controls Google? Of the 6 Google executives, 4 are jews or have jewish spouses. (jewish overrepresentation of 3,350%)
Who controls Amazon? Of the 11 Amazon executives, 8 are jews or have jewish spouses. (jewish overrepresentation of 3,650%)
Who controls Facebook? Of the 3 Facebook executives, 3 are jews or have jewish spouses. (jewish overrepresentation of 5,000%
Who controls Microsoft? Of the 17 Microsoft executives, 6 are jews or have jewish spouses. (jewish overrepresentation of 1,750%)
Who controls the Economy? Of the 60 senior officials of the US monetary institutions, 39 are jews or have jewish spouses.
(jewish overrepresentation of 3,250%)
Who controls the Mutual Fund Industry? Of the 40 senior executives of the major Mutual Funds on Wall Street, 26 are jews or have jewish spouses.
(jewish overrepresentation of 3,250%)
Who controls Professional Sports? Of the 60 senior executives of the major sports leagues, 43 are jews or have jewish spouses.
(jewish overrepresentation of 3,600%)
Who controls the Southern Poverty Law Center? Of the 22 senior members, 15 are jews or have jewish spouses. (jewish overrepresentation of 3,100%)
Who controls the American Civil Liberties Union? Of the 9 executives of ACLU, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,200%)
93
Who controls Goldman Sachs? Of the 9 GS executives, 7 are Jews or have jewish spouses. (jewish overrepresentation of 3,900%
Who controls JPMorgan? Of the 10 JPM executives, 9 are jews or have jewish spouses. (jewish overrepresentation of 4,500%)
Who controls the Treasury Department? Of the 26 senior Treasury officials, 18 are jews or have jewish spouses.
(jewish overrepresentation of 3,450%)
Who controls the Federal Reserve System? Of the 7 FR governors, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,850%)
Who controls the White House? Of the 11 senior advisors of president Obama, 9 are jews or have jewish spouses.
(jewish overrepresentation of 4,100%)
Who controls Senate? Of the 20 US Senate Committee Chairmen, 8 are jews or have jewish spouses.
(jewish overrepresentation of 2,000%)
Who controls Congress? Of the 42 US House Committee chairmen, 6 are jews or have jewish spouses.
(jewish overrepresentation of 700%)
Who controls the Supreme Court? Of the 9 SC justices, 4 are jews or have jewish spouses. (jewish overrepresentation of 2,200%)
Who controls the State Department? Of the 74 senior SD officials, 40 are jews or have jewish spous- es.
(jewish overrepresentation of 2,700%)
Who controls the Justice Department? Of the 47 JD officials, 22 are jews or have jewish spouses. (jewish overrepresentation of 2,360%)
Who controls the Anti-Defamation League? Of the 53 executives of the ADL, 53 are jews or have jewish spouses.
(jewish overrepresentation of 5,000%)
Who controls the Defense Department? Of the 110 DD officals, 40 are Jews or have jewish spouses. (jewish overrepresentation of 1,800%)
Who controls the Group of Thirty? Of the 43 GoT members, 23 are jews or have jewish spouses. (jewish overrepresentation of 21,200%)
Who controls the Bilderberg Group? Of the 35 committee members, 16 are jews or have jewish spouses.
(jewish overrepresentation of 4,600%)
Who controls the Trilateral Commission? Of the 56 committee members, 23 are jews or have jewish spouses.
(jewish overrepresentation of 16,400%)
Who controls the Council on Foreign Relations? Of the 43 CoF directors, 28 are jews or have jewish spouses. (jewish overrepresentation of 3,250%)
Who controls the Ivy League? Of the 24 senior administrators, 20 are jews or have jewish spouses.
(jewish overrepresentation of 4,150%)
Who controls the Think Tanks? Of the 30 senior executives, 18 are jews or have jewish spouses. (jewish overrepresentation of 3,000%)
“We have corrupted the blood of all the races of Europe — perhaps we have infected them. Today, everything is Jewdified. Our thinking is in everything living, our spirit rules the world. We are the masters, for everything that has power today is the child of our spirit. One may hate us, one may drive us away. Our enemies may triumph over our physical weakness. But we are no longer to be gotten rid of. We have devoured the peoples, conquered the races, defiled them, broken their strength, made eve- rything rotten, lazy, and corrupt with our stale culture. Our spirit can no longer be exterminated.”
-Dr. Kurt Münzer [Jew] in his novel 'Der Weg nach Zion' (The Way to Zion)
It gets worse.
94
List of most popular websites
From Wikipedia, the free encyclopedia
Alexa top 100 global SimilarWeb top 100 Domain websites websites Type (As of April 3, 2017)/2! (As of May 2017)!
Principal country
google.com Internet services and products ЕЕ 05. youtube.com Video sharing ШЕШ 05. facebook.com Social network =z US.
Mark Zuckerberg Facebook, Inc. Sheryl Sandberg
Key people Mark Zuckerberg (Chairman and CEO) Sheryl Sandberg
(СОО) Sandberg was born іп 1969 іп
Zuckerberg was raised|Jewishjand had his Ваг Р 9 Sundar Pichai Washington, D.C. to a[Jewist]famity
Mitzvah when he turned 13.1211
Alphabet Inc.
oe || 7mm.
August 2014 "Do the right thing" Type Subsidiary Formerly Google Inc. (1998-2015)
ES (used from 2004-2015)
Internet Larry Page Computer software Computer hardware September 4, 1998; 18 years ago Menlo Park, Californial!1t2] Founders Larry Page
Sergey Brin "- Headquarters Googleplex, Mountain 8 HAA R E I Z
View, California, U.S.) à Tund MM Lawrence Edward Page was born on March 26, 1973, in East
Key people Sundar Pichai (CEO) Lansing, Michigan. His father, Carl Vincent Page, Sr., was a Larry Page (CEO - Alphabet Inc.)
Sergey Brin (President = his mother, Gloria W. Page, also taught computer programming. Alphabet Inc.) Page speaking at the European Parliament on
June 17, 2009 Gloria i Jewish] Carl, who died, in 1996, was not. Susan Wojcicki YouTube, LLC
Pichai was born in Madurai, Tamil Nadu, India
professor of computer science at Michigan State University, where
Sergey Brin Early life and education езі]
Brin was born in Moscow in the Soviet Union, to Russian Pewish] parents 0 | | e
Spouse(s) Anne Wojcicki (m. 2007;
div. 2015)/41°1 YouTube now operates as one of Google's subsidiaries.
Anne Wojcicki
e
She is the current CEO of YouTube.
Sergey Brin in 2008 She is the daughter of Esther Wojcicki, an educator of Russian|Jewish|des
Anne E. Wojcicki (/моо d3rtski/ woh-JIT-skee; Polish: Wójcicka pronounced [vuj Yitska}; born July 28, 1973) is an American entrepreneur and the co-founder and chief executive officer of the personal genomics company 23andMe. She was formerly married to Google co- Her mother is Her sisters are Susan Wojcicki, CEO of YouTube and a former executive at Google
Wojcicki at TechCrunch Disrupt SF 201
90% of american media is owned by 6 corporations: a demonstrable fact everyone can research and see. The CEOs and executives of those 6 corporations are jewish: also demontrable by looking at those corps employee charts. But Jews insist in calling it a "conspiracy theory", even though no "conspiracy" is involved, and none of this is theoretical.
Peter Chernin ХХ Gerald ТеуіпХХ Michael LyntonXX Brian RobertsKX Sumner RedstoneXx Michael Eisner XX News Corp Фу 7 TimeWarner SONY COMCAST масом
J EF ао ge. [] NATIONAL
GEOGRAPHIC
CHANNEL
hulu »
е... өше T ТІМЕ
өй іа Entertainment Southern Living
hulu
THE INTERNATIONAL JEW: Controlling the world's sources of news, All ! THE WORLD'S
Judaan [Jews] can always prepare the minds of FOREMOST PROBLEM the people for its next move. The greatest ге
exposure yet to be made is the way that news is
manufactured and the way in which the mind of
whole nations is molded for a purpose. When the powerful Jew is at last traced and his hand j
revealed, then comes the ready cry of persecution
and it echoes through the world press. The real / N causes of the persecution (which is the oppression - d THE COMPLETE
of the people by the financial practices of 5.2 4 VOLUMES the Jews) are never given publicity
HENRY FORD. 1920
96
Who are the workers?
Do members of the jewish race have a naturally weakened immune system? Would this make them ideal hosts for parasite-infested mind control?
WATCH KABBALAT SHABBAT LIVE! // Stream services here at 7:25 pm Central/8:25 pm Eastern. —>
included in an expanded 38-disease panel. Another 16 diseases
for genetic testing recommended by the Jewish
Genetic Diseases Consortium. An additional 19 are
are common among particular groups of Sephardic * | and/or Mizrahi * Jews. Information on the latter two groups of
Di : diseases are available on the JGDC website. purs
Asked Que
HEALTH & WI
Advertisement Bloom syndrome is a disorder that can result in short stature,
skin rashes, sensitivity to sunlight, high-pitched voice,
distinctive facial features, infertility and a heightened risk of My Jewish Learning is a not
several other diseases, including cancer, pulmonary disease and relies on your hq immune system abnormalities. Life span is often significantly DONATE shortened due to susceptibility to cancer and other
complications. Carrier frequency is one in 134 Ashkenazi «
Jews.
Further Resources: National Institutes of Health
Bloom's Syndrome Foundation
Bloom's Syndrome Association BloomSyndrome Foundation (Netherlands) Bloom's Syndrome Registry
Blooms Connect
Canavan Disease
Canavan Disease is caused by the deterioration of white matter in the brain, which in turn impedes the function of nerve cells throughout the body. Symptoms typically occur within the first nine months of life and include a failure to develop basic motor skills, enlarged head and poor muscle tone. Over time, seizures, difficulty in swallowing, paralysis and retardation can result. Affected individuals typically live through childhood only, though some have survived into adolescence and beyond. A milder and less common form of the disease features far less dramatic symptoms that are sometimes never recognized and do not appear to shorten lifespan. About 1 in 55 Ashkenazi Jews are
carriers of the disease.
Further Resources: National Institutes of Health Canavan Foundation
Canavan Research Foundation
Cystic Fibrosis
Cystic Fibrosis is a condition in which the body produces a thick mucus that can clog the lungs and impair organ function. Symptoms can include wheezing, chronic coughing and inflammation leading to breathing problems and bacterial infections in the lungs. Over time the condition can cause digestive problems and reduced pancreatic function. Improved treatments have led to increased lifespan in recent decades, with many sufferers in the United States now surviving into their 30s and 40s. Carrier frequency is about 1 in 24 Ashkenazi Jews and about 1 in 26 Sephardic/Mizrahi Jews.
Further Resources:
National Institutes of Health
Cystic Fibrosis Foundation
Boomer Esiason Foundation
Cystic Fibrosis (online community)
CF Living
Cystic Fibrosis Worldwide
Cystic Fibrosis-Reaching Out Foundation Cystic Fibrosis News Today
Familial Dysautonomia
Familial Dysautonomia is a disorder that affects the autonomic nervous system, which controls involuntary actions, and the sensory nervous system, which controls activities related to the senses. The disorder features a wide range of symptoms that typically begin in infancy and increase in number with age. These include poor muscle tone, feeding difficulties, poor growth, lack of tears, frequent lung infections and difficulty maintaining body temperature. In older children, the disease can result in bed wetting, vomiting, reduced sensitivity to temperature and pain, poor balance, scoliosis, kidney and heart problems, and learning difficulties. Affected adults can suffer from lung and kidney problems and impaired vision. The disease results in shortened lifespan, with affected individuals born in 2006 projected to have a 50 percent chance of survival to age 40.
About 1 in 31 Ashkenazi Jews are carriers of the disease.
Further Resources: National Institutes of Health
Dysautonomia Foundation
National Dysautonomia Research Foundation Familial Dysautonomia Now Foundation Familial Dysautonomia Hope Foundation Dysautonomia Youth Network of America
Familial Hyperinsulinism
Familial Hyperinsulinism is a condition that causes irregular levels of insulin, the hormone that controls blood sugar levels. Symptoms can occur very soon after birth, and can include lethargy, hypoglycemia, seizures and difficulty feeding. Repeated episodes of low blood sugar can lead to more serious complications. Treatment with drugs or glucose injections can help manage the disease. Surgery to remove all or part of the pancreas is also common. The carrier frequency for Familial Hyperinsulinism is about 1 in 68
Ashkenazi Jews.
Further Resources: National Institutes of Health
Congenital Hyperinsulism International
Fanconi Anemia C
Fanconi Anemia C is one of several subtypes of a disorder that impairs the ability of bone marrow to produce new blood cells. Signs of the disease are often apparent at birth. Affected individuals often suffer from bone marrow failure, infertility, short stature, increased incidence of certain types of cancer, gastrointestinal difficulties and various physical abnormalities. Drugs and bone marrow transplantation are used to manage the disease, but most of those affected die in early adulthood. The carrier frequency among Ashkenazi Jews is 1 in 100.
Further Resources: National Institutes of Health
Fanconi Anemia Research Fund
Gaucher Disease
Gaucher disease is the most common genetic disease affecting Ashkenazi Jews. The disease results from a specific enzyme deficiency that can impact many of the body's organs and tissues. There are various types of the disease. The most common is Type 1, whose symptoms include enlargement of the liver and spleen, anemia, low red blood cell count, lung disease and bone abnormalities. Other forms of the disease affect the cardiovascular and central nervous systems. Symptoms can vary widely in intensity. Some of those affected with the more severe forms may suffer extremely shortened lifespans, while others can manage the disease successfully over the long term. The carrier frequency for
Ashkenazi Jews is about 1 in 15.
Further Resources:
National Institutes of Health National Gaucher Foundation Children's Gaucher Research Fund
Joubert Syndrome 2
Joubert Syndrome 2, also known as Cerebelloculorenal Syndrome, is a subtype of a condition whose symptoms include poor muscle tone, abnormal eye movements, intellectual disability and poor motor coordination. Though symptoms can vary, the condition is marked by the underdevelopment of the cerebellar vermis area of the brain, which controls balance and coordination. The condition can also be associated with kidney or liver failure. Symptoms typically begin in infancy. Treatment options are solely supportive and symptomatic. The carrier frequency among Ashkenazi Jews is 1 in 100.
Further Resources: National Institutes of Health
Joubert Syndrome & Related Disorders Foundation
Lipoamide Dehydrogenase Deficiency (E3)
Lipoamide Dehydrogenase Deficiency (E3) is a condition caused by an enzyme deficiency that leads to the buildup of lactic acid in the body. The symptoms typically present in childhood and are quite varied, including serious fatigue, episodes of hyperventilation, vomiting and abdominal pain. The disorder can be fatal in childhood, though it can also often be managed through diet and immediate medical attention when lactic acid buildup
occurs. The carrier frequency among Ashkenazi Jews is 1 in 107.
Further Resources: National Institutes of Health
Genetic Disease Foundation
Maple Syrup Urine Disease (1B)
Maple Syrup Urine Disease is a disease characterized by deficiency in enzymes needed to break down certain amino acids. The disorder derives its name from the distinctive sweet odor of the urine of those affected. Symptoms typically begin shortly after birth and indude irritability, poor feeding and lethargy. The disease can usually be successfully managed through a strict dietary regimen, but left untreated can lead to neurological
damage, seizures, coma and death. The carrier frequency among Ashkenazi Jews is 1 in 97.
Further Resources: National Institutes of Health
National Organization for Rare Disorders MSUD Family Support Group
Mucolipidosis IV
Mucolipidosis IV is a disorder characterized by severe underdevelopment of intellectual and motor skills. Symptoms are usually apparent within months of birth. Many of those affected have limited or absent speech, impaired vision, difficulty walking independently, digestive problems and poor muscle development. Though many of those affected by the disease survive into adulthood, they may still have shortened lifespan. The carrier frequency among Ashkenazi Jews is 1 in 89.
Further Resources:
National Institutes of Health
National Organization for Rare Disorders Mucolipidosis IV (ML4) Foundation
Nemaline Myopathy is a disease characterized by muscle weakness, typically in the face, neck and other muscles close to the center of the body. Symptoms are generally present in childhood and can vary widely in intensity. In severe cases, weakness in the respiratory muscles can be life-threatening, but in most cases affected individuals can lead active
lives. Carrier frequency in Ashkenazi Jews is 1 in 168.
Further Resources:
National Institutes of Health
National Organization for Rare Disorders A Foundation Building Strength
Nemaline Myopathy Support Group Walker Warburg
Walker Warburg is a disease characterized by severe abnormalities in the muscles, brain
and eye. Symptoms are typically evident very early in life and include severe retardation, small head, poor muscle tone, small eyes, blindness, seizures and feeding difficulties. Most affected individuals do not survive past the age of three. Carrier frequency is 1 in 120 for
Ashkenazi Jews.
98
Niemann-Pick Disease
Niemann- Pick refers to a collection of metabolic disorders characterized by an enzyme deficiency that leads to the buildup of certain types of lipids in the body. Individuals affected with the most severe and most common form, Type A, typically develop an enlarged liver and spleen within the first three months of life, followed by a progression of other symptoms that normally lead to death within the first four years. Other subtypes generally develop later and are not as severe. Carrier frequency among Ashkenazi Jews is lin 115.
Further Resources: National Institutes of Health
National Niemann-Pick Disease Foundation
Spinal Muscular Atrophy
Spinal Muscular Atrophy is a disorder caused by the loss of motor neurons in the spinal cord and brainstem. The disease has multiple types distinguished by the age of onset and the severity of symptoms. In the most severe forms, symptoms begin very early and often lead to death within several months to two years as a result of respiratory problems. With milder forms, symptoms begin later in childhood or even into adulthood and, depending on their severity, can sometimes permit a normal lifespan. All forms of the disease involve some degree of muscular weakness that can lead to atrophy as well as difficulty walking, breathing and eating. Carrier frequency is 1 in 41 for Ashkenazi Jews and 1 in 10 for Egyptian Jews.
Further Resources: National Institutes of Health Cure SMA
FightSMA Spinal Muscular Atrophy Foundation Spinal Muscular Atrophy
Tay-Sachs Disease
Tay-Sachs Disease is a disorder characterized by an enzyme deficiency that destroys neurons in the brain and spinal cord. The most common form of the disease begins within months of birth and entails the progressive loss of motor skills, neurodegeneration, seizures, blindness, spasticity and eventually total incapacitation and death. A far more rare form of the disease begins later in life, from childhood to adolescence and beyond, and the symptoms are milder, though they include poor coordination, tremors and slurred speech. As the disease progresses, it can lead to mental and behavioral abnormalities, induding bipolar disorder and psychoses. Carrier frequency
for infant onset Tay-Sachs among Ashkenazi Jews is 1 in 27.
Further Resources: National Institutes of Health
National Tay-Sachs and Allied Diseases Association Cure Tay-Sachs Foundation
Torsion Dystonia
Torsion Dystonia, also known as dystonia musculorum deformans, is characterized by muscle spasms, contractions, and tremors. Symptoms usually begin in early childhood and are progressive. Sometimes symptoms are isolated in one part of the body, and sometimes affect many. The disease is caused by a mutation in the TOR1A gene, but not all people with the mutation develop the disease (only 30-40%). Somewhere between 1 in 3000 and 1 in 9000 Ashkenazi Jews are affected by this disorder.
Further Resources:
National Institutes of Health
Usher Syndrome
Usher Syndrome is a disorder that affects nerve cells in the ear and photoreceptor cells in the retina. The disease is marked by total or partial loss of vision or hearing that worsens with time. There are several types of the disease. In Type 1, affected individuals are typically born with hearing loss and difficulty balancing due to abnormalities in the inner ear. In Type 3, vision and hearing loss typically begin later in life. Carrier frequency for Type 1F is 1 in 147 for Ashkenazi Jews and 1 in 120 Ashkenazi Jews for Type 3.
Further Resources:
National Institutes of Health Usher Syndrome Coalition Hear See Hope
Who are the workers?
Why do jews often claim to be part of the ‘collective’? Do parasites cause schizophrenia?
Are jews prone to schizophrenia?
@ pubmed.ncbi.nim.nih.gov/7973467/
Abstract
To limit the genetic heterogeneity of schizophrenia, this study focused on the widely extended pedigrees of Ashkenazi Jewish schizophrenia probands. The hypothesis posed is that the increased prevalence among the Ashkenazim of the rare lysosomal enzyme disorders, Tay Sachs disease (TDS), caused by low levels of hexosaminidase A, and Gaucher's disease (GD), caused by low levels of glucocerebrosidase, might contribute to the demonstrated increased vulnerability to schizophrenia in this ethnic group. Signs and symptoms characterizing the candidate illnesses were systematically queried by the family history method. Rates and relative risks for symptoms characterizing these disorders and for several nonautosomal illnesses associated with TSD and/or GD (i.e., amyotrophic lateral sclerosis and Hodgkin's disease, leukemia and lymphoma) are significantly elevated in the schizophrenia pedigrees, compared to controls. The conditions with elevated rates and risks have been associated with chromosomal regions 1q21 and 15q23-q24. These areas are suggested as candidate regions for future targeted deoxyribonucleic acid (DNA) research in schizophrenia.
Jewish insanity
Among the Jews, the proportion of insane has been observed to be very large.’ From statistics collected by the German researcher Buschan in the late 19th century, he concludes that they are four to six times more liable to mental disease than are non-Jews. Lombroso quotes Servi ("Gli Israeliti di Europa," 1872) to the effect that in Italy there is one insane among 391 Jews, nearly four times as many as among the Catholic population of that country. Verga ("Archivio di Statistico," 1880) shows that in 1870 there was one insane among 1,775 Catholics in Italy, while with the Jews it reached the alarming proportion of one insane in
i
+ “AN ге! n Nos. 9
Е 384 of population. A similar phenomenon has been 52 . observed in other countries. In the various provinces of E ЕН Germany and also іп Denmark the percentage of Jewish a insane is very large, as is seen from the figures in the
appended table on the left.
Maximoff and Sikorsky (Proceedings of the Twelfth International Medical Congress," vol. iv., part 1., p. 661.) have shown that similar conditions prevail in Russia. Among the troops in Kiev, respectively 0.91% and 0.99% of Russians and Poles were determined to be insane. For Jews, this number was more than
twice as high: 2.19%.
C. F. Beadles, who has investigated the subject in the Colney Hatch Asylum in London, shows that there appears to be a great preponderance of general paralysis among Jewish males, over 21 per cent of all the male Jews admitted being subjects of that disease, while the proportion of cases of general paralysis among all the males admitted to the hospitals for the insane in England and Wales is only 13 per cent. "It is evident," says Mr. Beadles "that among the Jewish males, admissions for general paralysis are 60 per cent more frequent than among the non-Jewish English and Welsh."
The frequency of general paralysis in Jews observed by Beadles is confirmed by Hirschl, who found among 200 of his paretic patients 40 Jews, 1.е., 20 per cent (Hirschl, "Zur Aetiologie der Progr. Paralysis," in "Jahrbuch für Psychiatrie," xiv. 449). Pilez also found a large proportion of pareties among the Jews in Vienna: 18.75 per cent of all cases. He adds that the Jews' acute struggle for existence, and their peculiar occupations as merchants, speculators, stockbrokers, etc., are etiological factors.
[1] http://www, jewishencyclopedia.com/articles/8 1 23-insanity
Who are the workers?
Why do jews often claim to be part of the ‘collective’?
Do jews use patriarchal lineage or matriarchal lineage to determine ‘Jewishness’? Define ‘congenital transmission’?
[...from mother to child]
What is the [real] reason jews use matriarchal lineage to determine ‘Jewishness’?
* Congenitally from mother to child |“ Through blood transfusion * Through organ transplantation
If the parasite fails to transfer in utero, is there an alternative method Jews use to transfer their parasites? Do parasites prefer young hosts?
Are mind-controlling parasites sexually transmitted?
Can they be transmitted through spit and saliva?
Would an open wound facilitate this transfer?
What is 'Direct Oral Suction’?
Circumcision >>> Parasite Parasite >>> Mental Illness Mental Illness >>> Hive Mind Hive Mind >>> Collective
Why do jews [really] claim to be part of the ‘collective’?
@ rules.cityofnewyork.us/tags/direct-oral-suction Search | Email Updates | Contact Us /isitors Government Office of the Mayor
SET TEXT SIZE: [=] [+] E) Ti TRANSLATE THIS PAGE = PRINTER FRIENDLY LOGIN | REGISTER
Adopted Rules: Closed to Comments
Adopted Rules Content:
Statement of Basis and Purpose
Statutory Authority
These amendments to the Health Code are promulgated pursuant to sections 558 and 1043 of the Charter. Sections 558(b) and (c) of the Charter empower the Board to amend the Health Code and to include in the Health Code all matters to which the authority of the New York City Department of Health and Mental Hygiene (the "Department") extends. Section 1043 of the Charter grants the Department rule-making authority. The amendment is also made pursuant to the Department's historic power to supervise the control of communicable disease in New York City.
Background
The Charter provides the Department with broad jurisdiction to protect and promote the health of all New Yorkers. The control of communicable disease is a core public health function. At its meeting on September 13, 2012, the Board of Health voted to amend Article 181 by adding a requirement that, prior to a circumcision involving direct oral suction (“005”) of infants less than 60 days of age, the person performing the circumcision obtain the written consent of a parent. In the consent, the parent acknowledges that he or she is aware that the Department recommends DOS, also known as metzitzah b'peh, not be performed because of the risk of brain damage and death.
Circumcisions that include DOS involve direct contact between the mouth of the practitioner designated by the religious community to perform a circumcision, known as a mohel, and the infant's circumcision wound. The opposition of some members of the Orthodox Jewish community who practice DOS has made enforcement of the consent requirement difficult. Since the provision went into effect, there have been six cases of herpes simplex-1 (HSV-1) infection reported in infants following DOS in New York City, including four cases reported in 2014. In two of these six cases, the mohel who was associated with the case was identified in the course of the Department's case investigation, and a signed consent form was provided by the mohel in one of these two cases. The limited effectiveness of the consent requirement at this time prompted the department to consider alternative approaches to address this problem.
In February, 2015, the Mayor announced a new strategy to address this problem. As part of this approach, the Department will work cooperatively with leaders of the Orthodox Jewish community to educate parents about the risks of DOS. These educational efforts will include working with hospitals throughout the City to distribute educational materials about the risks of DOS to the parents of all newborn infant boys, as well as making this information available at other health care settings, such as obstetric and pediatric practices. These materials, which include a Department telephone number for parents who may have questions, have been translated into Yiddish and are being distributed at hospitals and medical offices that service communities where DOS is practiced. The Department's educational initiative is more likely to succeed if the Department can restore a strong relationship with these communities. Accordingly, the Board is repealing section 181.21 of the Health Code.
101
Do the infected live in filth and squalor? Are jews sometimes referred to as ‘goblins’? Why is ‘goblin mode’ spreading?
J that men and women were w of one another, They have toilets, But these god. up. The filth,” Craig rooms 1 saw six
Life and style Slobbing out and giving up: why are so many people
going ‘goblin mode’?
THE WORMS CRAWL IN, THE WORMS CRAWL OUT —
Old stone toilet reveals Jerusalem’s wealthy elite had intestinal parasites
Scientists identified egg remnants from roundworm, tapeworm, whipworm, and pinworm.
1/14/2022, 11:44 AM
Does early infection result in morphological changes to the host's body?
Could this be used to identify the infected?
[а]
@ pubmed.ncbi.nlm.nih.gov/23225875/
What is ‘Aggressive Mimicry’?
> J Exp Biol. 2013 Jan 1;216(Pt 1):127-33. doi: 10.1242/jeb.073635.
Influence of latent Toxoplasma infection on human personality, physiology and morphology Sees cons of the Toxoplasma-human model in studying the manipulation hypothesis
Wasmannian Mimicry
In Wasmannian mimicry, the mimic resembles a model that it lives along with in a nest or colony. The mimic, a predator, appears as a friend and member of the same species, taking on its appearance and mannerisms.
Aggressive mimicry
From Wikipedia, the free encyclopedia
Aggressive mimicry is a form of mimicry in which predators, parasites, or parasitoids share similar signals, using a harmless model, allowing them to avoid being correctly identified by their
prey or host. Zoologists have repeatedly compared this strategy to a wolf in sheep's clothing. 2131 aggressive mimicry could include various types of exploitation,
14 In its broadest sense,
SW EU
European woman (top) ы Jewess (bottom)
Ant in Mozambique (top) Mimic, a jumping spider (bottom)
102
. Jews, traditionally. |
All dogs are bad and their owners accursed, Israeli city's rabbis rule
Religious edict in haredi town of Elad says canines are forbidden because they bark at people and may scare them: 'And because of its bark it is a bad dog even if does not bite’
By CNAAN LIPHSHIZ 12 July 2019, 4:50 pm |
LHE JERUSALEM POST CORONAVIRUS ISRAEL NEWS WORLD NEWS MIDDLEEAST BUSI
An annual fee, proposed by United Torah Judaism MKs Moshe Gafni | 6 k ere
Dogs can smell when one is infected with parasites:
4.3.4 The Dog of Alba
Another literary tradition, which, however, is not connected to the culinary topoi discussed so far, but which is gladly taken up in connection with the topic of the foetor judaicus, is the story about the dog of Alba. The story must have been told before the expulsion of the Sephardim from the Spanish kingdom in 1492, since it involves the Jewish community of Alba. According to Joseph Eugene Gillet (1888-1958), Professor of Romance Languages, who analyzed and published the various texts in an essay, the oldest version known today, which was written in verses, comes from Johannes de Trasmiera, whose texts probably appeared in print іп 1524 or a short time later."
The story tells of the dog of Anton Gentil, who attacks only Jews іп the city of Alba. Alba probably means the small town of Alba de Tormes, in which the ancestral seat of the Dukes of Alba is located, because the duke is also referred to in onc place.** Should the Duke of Alba actually be meant, the period of the story can be narrowed down even more, because the Alvarez de Toledo family were Counts of Alba until 1472 when Castilian King Henry IV conferred the title of duke
version that we have received from Johannes de Trasmiera was not even the first one. The story goes
AC зогу BOCS on to explain that Jews take the biting dog to court. The judge sentences the dog to death and lets him be handed over to the Jews so that they can punish him and take revenge. However, the dog
is would-be executors again. to move to coming into the city, even if he is disguised as a Christian:
“If any Jew showed up
disguised as a Christian,
and touched him [the dog] with their hand, which he [the dog] immediately kissed,
he tore the Jew's hand apart,
since such a disguise did not trick him,
if a Christian dressed like a Jew,
he then remained seated.”*5
Stigmatizing New Christians in Early Modern Spain- Julia Gebke
(10: -DFt4lpüR ) == 10/28/21(Thu)23:49:22 0.345241781 »
22345224619 #
I'm trans but i like to pretend I'm not when Dogs Can Sense I'm on the internet. | dont really have a lot
Bad People of friends in real life. | think they don't
according bs science really like my humor. | never really feel like | have a community more than when I'm teasing other transgenders on 4chan d because I've never seen a group of
people having more fun. | don't blame
Dogs Can Sense Bad iris them for hating us because i hate myself
too.
i | have a friend from childhood who told People according to me to get a pet and i really like doggos but | noticed that every dog seems to science. hate me so i don't want to get one. | think
its because i STANK
104
An interesting story: >you probably won't believe this but..
If you think that is unbelievable. Let me tell you my story. When I was young, | distinctly remember the day my life changed. | was an outgoing, charismatic child who quickly made friends with everyone. My parents even had to impose limits on the number of kids | could invite to my birthday parties (to the disappointment of many). Then, when | was 11, | specifically remember not only the day, but even the very moment 1 lost control over my behavior. A spirit of fear came upon me so suddenly and with such force that I lost the ability to speak to strangers, nor could | even stand in front of crowds without visibly shaking in abject terror. | also noticed around this time, dogs began to attack me on sight. Not just one dog, or two dogs, but a great many dogs. Even the friendliest of them would not hesitate to sink their teeth deep into any part of me that | carelessly left exposed. Their owners were always flabbergasted and apologized to no end, but | learned to expect it, and | had to keep my distance from certain breeds.
What makes my story even more strange was that | also distinctly remember not only the day, but even the very moment | regained control over my body. It was exactly 20 years later. | was required to give a speech, and | suffered so much mental anguish from it that | felt like something inside of me suddenly broke. That moment, whatever had been controlling my body had vanished. Within a week, the crippling fear which had previously enveloped my mind was now no more. What is even more strange is that giving public speeches suddenly became my new favorite thing in the whole world. It was as if my life had returned to the state in which it was in back when | was eleven. Even dogs forgot their hatred of me.
| probably would have forgotten all of this but for a very similar thing happening to my four year old niece. You see, a family member of mine has the friendliest dog in the world. But for reasons that we did not understand, one day, the dog tries to kill my niece. She was not hurt, but we have had to keep the dog and my niece separated ever since. No one understood why. We still don't understand why, but something strange happened to my niece not long after this. You see, almost a year later, my niece is suddenly diagnosed with a massive brain tumor.
No one believes my theory, but | can't help wondering if, just like me, something had gotten inside my niece, and the dog could sense it. And whatever that thing was inside of her, it somehow caused that tumor. | know this sounds unbelievable, but do you think dogs can sense ghosts, or whatever that thing was inside of her and me?
Ш medicalnewstoday.com/articles/323620#summary
= NEWSLETTER MepicaLNewsTopay
Can dogs sense tumors?
Researchers are currently exploring the possibility of using specially trained medical detection dogs in the diagnosis and tracking of cancer.
Canine cancer detection is a simple, noninvasive procedure with potentially fewer side effects
: for people. However, further investigation is necessary to validate this method for use in clinical Or do dogs sense parasites practice.
which cause the tumors?
Hollywood coincidence or truth disguised as fiction? LINK Why do jews [really] hate dogs?
105
SCIENCE пот HEED -a
ft News Space& Physics Health РізпегЕапһ — StrangeNews Animals History | Forums
7 Strange Facts about the 'Mind-Control' Parasite Toxoplasma Gondii
By Stephanie Buck October 18, 2016 К " Source: https:/www livescience.com'56529-strange-facts-about-toxoplasme-gondil-parasite html Can a parasite control your mind?
A single-cell parasite, Toxoplasma допаї is perhaps best-known for its connection to cats. The parasite can move from its feline host to humans, most commonly through contact with cat feces. And while the parasite typically only causes mild Infection (people may have flulike symptoms), in people with weakened Immune systems, infections can cause serious problems, from seizures to severe lung problems.
But a Т. gondil infection can also have some downright bizarre effects. Over the years, the parasite has not only surprised and stumped researchers, but has also led to new insights into how human behaviors work.
T. gondii has been shown to increase fearlessness in rats.
Rats infected with the parasite seem to lose their typical fear of cats, and more specifically, their fear of cat urine. A 2011 study in PLOS ONE suggested that infected rats start to feel a type off'sexual attraction ]to the smell of cat urine, rather than their usual defensive response to the scent.
This might be because a Т. gondii infection changes neural activity in certain areas of the brain, the researchers said. The parasite “averwhelms the innate fear response" so that rats no longer avoid the scent of cat urine, they wrote. Instead, the amorous rats are drawn to it — and to their deaths.
T. gondii can leap between almost all warm-blooded animals.
Cats and rats aren't the only animals that can host the parasite. T. gondijis an exceptional parasite in that it can leap from almost any warm-blooded creature to
another. Although an estimated 6 in cf 10 infectious human diseases are zoonotic (meaning they can hop from animals to humans), hardly any share 7. gondi/s wide versatility of host organisms, according to the Centers for Disease Control and Prevention.
Scientists havent pinpointed exactly why this is, but some research, such as a 2011 study published in the Proceedings of the National Academy of Sciences, suggests that at least part of the answer may be found in the parasite's proteins: When a certain type of protein is removed, the parasite is no longer virulent, Researchers speculate that this is because those proteins disrupt key proteins in the host's cell that are key to the host's immune response.
Others suggest that T. gondii could contribute to other types of mental illness, even suicide. Schizophrenia isn't the only psychological disorder that is possibly linked to T. gondii. А 2011 study that was done in mice and published in the journal PLOS ONE
owed that the parasitemay cause infected brain cells to release high levels of the neurotransmitter dopamine.
Increases in doparninefould play a hand in certain mood disorders, such as bipolar diseaseJwhiclt has been linked to dopamine irregularities, according to the study.
Other research done in humans suggests that Toxoplasma could be connected to impulsivity, and even suicide.
The parasite wouldn't be the first pathogen to alter people's brain and behavior: The rabies virus, which is deadly in people, has long been shown to have devastating neurological effects.
Some studies suggest that|T. gondii is linked to schizophrenia.
One of Toxoplasm4's most frightening — and most controversial— possible effects is its impact on the mind. If a woman is infected with the parasite while she is pregnant, her fetus may be at risk for developing schizophrenia and other mental disorders, according to a 2006 study of people living in ark, published in the. journal Biological Psychiatry.
And that's notall. A 2014 study that was published in The Journal of Nervous and Mental Disease f in patients with schizophrenia, providing further evidence for a potential link between the parasite and the mental illness.
T. gondii has no cure. There are no medications available to treat T. gondii, Other than remaining vigilant to try to prevent infection, there's not too much else to do.
Іп a 2005 study in the American Journal of Obstetrics and Gynecology, health care providers advised pregnant women and women looking to become pregnant to get screened for T. gondii. Тһе authors also suggested that women understand the risk factors for infection, such as exposure to cats (and particularly litter boxes and feces), consuming improperly cooked meat and drinking untreated water.
Up to half of the world may be infected. Researchers can't seem to agree on just how widespread T gondiiis, in part because many cases may go unreported. A 2002 study in the journal Clinical Microbiology
id Infection estimated that between 16 to 40 percent of people worldwide are infected, but in certain regions, such as parts of Central America, South America and continental Europe, the rates are between 50 to 80 percent.
A 2011 study in the Journal of Glabal Infectious Diseasesgave a much higher estimate of the numbers of people infected: about 6 billion people worldwide, or more than 80 percent of the world.
The Centers for Disease Control and Prevention estimates that about 60 million people in the United states — or nearly 20 percent — are infected. A simple blood te: can determine whether you have T. gondii antibodies, which indicate infection with the parasite. [7 Absolutely Horrible Head Infections]
Though T. gondii can cause flulike symptoms in mild cases, a 2014 study in the American Journal of Tropical Medicine and Hygienesuggested that in the vast majority of cases, people experience only mild symptoms, or по symptoms at all. Indeed, this may be why the parasite has been largely neglected by researchers, the authors Wrote.
The parasite is most dangerous to those with preexisting conditions, such as diseases that contribute to a suppressed immune system. But most people infected with T. gondii wil never even know they have it
Rabbi Fears Genetic Studies Will
Show That Jews Carry Genes That Are Polluting The World'
FEBRUARY 20, 2020 By СЕТТЕАМ — 11 COMMENTS
Because of the statistically high incidence of[schizophrenia] land Pipolar disorder] disorder|in the Jewish
Ashkenazi community, there have been several ongoing medical studies requesting volunteers to
help scientists better understand the biological basis of these condition:
Homosexuality and Judaism From Wikipedia, the free encyclopedia
"LGBT topics and Judaism" redirects here. For transgender topics in Judaism, see Transgender people and religion § Judaism.
The subject of homosexuality and Judaism dates back to the Torah. The book of Vayikra (Leviticus) is traditionally regarded as Classifying sexual intercourse between males as а foelvan (something abnorred or detested) that can be subject to captal punishment by the currently non-existent Sanhedrin under halakha (Jewish law)
The issue has been a subject of contention within modem Jewish denominations, and has led to debate and division. Traditionally. Judaism has understood homosexual male intercourse as contrary to Judaism, and this opinion is still maintained by Orthodox Judaism.
On the other hanc, Reconstructionist Judaism and Reform Judaism do not hold this view, and allow both homosexual intercourse and same-sex marriage. Conservative Judaism's Committee on Jewish Law and Standards, which until December 2006 held the зате position as Orthodoxy, has since issued multiple opinions under its phiosophy of pluralism; one opinion continues to follow the Orthodox position while another opinion substantially liberalizes the view of homosexual sex and relationships (while continuing to regard certain sexual acts as prohibited).
gayest city on earth
QAI images News |) Videos Q Shopping + More
About 760,000 results (0.71 seconds)
Tel Aviv
Tel Aviv Pride Parade is widely recognized as one of the leading parades in the world, with The Boston Globe dubbing Tel Aviv “the World's Gayest City” and Out Magazine calling it “the Gay Capital of the Middle East.” Jun9.2017
htips://mfa.gov.il» israelexperience» lifestyle» pages» те... + Tel Aviv hosts largest gay parade ever held in the Middle East
(О Anonymous (1D: QUEENS) 55 07/01/24 (Thu)17-50:55 No 328373101 » zsszsszaosz File: say eus png (181 KB, 7404749)
Sexual Orientation and Behavior of Adult Jews in Israel and the Association With Risk Behavior
Zohar Mor 1, Udi Davidovich 2
Affiliations 4- expand PMID: 26754157 DOI: 10.1007/510508-015-0631-0
Abstract
Estimating the size of key risk groups susceptible to HIV/sexually transmitted diseases (STI) is necessary for establishment of interventions and budget allocation. This study aimed to identify various dimensions of sexual orientation and practices in Israel, and correlate the findings with sexual risk behavior (SRB). It used a random representative sample of the Jewish population aged 18-44 years who completed online questionnaires regarding their self-identified sexual orientation, attraction and practices, and SRB. Concordant heterosexuals were those who self-reported heterosexual identity, were attracted and had sex only with the opposite gender. National estimates regarding prevalence of gay, lesbian, and bisexual men and women were based onthe civil census. The sample included 997 men and 1005 women, of whom 11.3 and 15.2 % were attracted to the same-gender, 0.2 ond 0.7 % reported lifetime same-gender encounter while 02 and 48 % self-identified as gay or bisexual men and lesbian or bisexual women, respectively. The ‘estimated population of self-identified Jewish gay or bisexual men and lesbian or bisexual women aged 18-44 in Israel was 94,176, and 57,671, respectively. SRB was more common among self- identified gays or bisexual men and among discordant heterosexual men and women. Those who reported same-gender sexual practices reported greater SRB than those who only had opposite- gender encounters. interestingly, SRB among discordant heterosexuals was associated with same- sex behavior rather than attraction. Health practitioners should increase their awareness of sexual diversity among their clientele, and should recognize that risk For HIV/STI may exist among self- identified heterosexuals, who may not disclose their actual sexual attraction or practices. Keywords: Bisexual; Gay men; Israel; Lesbians; Sexual orientation.
Around 10% or awen mates are romosexual.
The jewish community is rife үйін homosexuality.
‘Aico koop in mind that Talmudic judaism beliavoc that god doocn' have any gendor. That god raprosonts the urion of
male and female. They even havea name forthe female aspect of god called Shekhinah. They also believe that Atam
was noi the frst human, but was created beside a female caled Lith.
https:/en.wikipedia org/vikiShekhineh.
They belleve tnat untying tne sexes s getting cicser to god. That's probably the root cause oll ins transgenderism stu.
Not Anudda Shoah!
It gets worse.
106
W: LIKE TO THINK Of ourselves as in the driver’s seat, choosing where to go,
whether to speed up or slow down, when to switch lanes. We make the decisions and bear the consequences. This is a convenient, even necessary belief. If we jettison the notion of free will, the laws that hold people accountable for their actions begin to crumble. The world becomes an unruly or even terrifying place.
Alien beings that turn us into zombies, bloodthirsty vampires, and sex-crazed La sz robots are standard sci-fi fare precisely because they evoke the horror of losing control or, worse, becoming slaves to creatures bent on exploiting us for their
own gain. So it’s disconcerting to think that an invisible passenger might also have a hand on the steering wheel, vying to move us in one direction when we’d 2 4 (YU rather go another. When we let up on the accelerator, an unseen foot presses f ES 0 N harder. | )
Parasites are like that invisible passenger. Adept at outwitting our immune | A systems, they sneak aboard our bodies and then the devilry begins. They cause rashes, lesions, aches, and pain. They eat us from the inside out; use us to incubate their young; sap our energy; blind, poison, maim, and sometimes kill , РГ ( us. But that’s not the full extent of their clout. Some parasites have another trick / ү up their sleeves—an awesome hidden power that astounds and confounds even scientists who study them for a living. Simply stated, these parasites are masters of mind control. Whether as tiny as a virus or as big as a six-foot-long tapeworm, they have found all kinds of devious methods to manipulate the How Tiny Creatures Manipulate behavior of their hosts, and that includes, many researchers now strongly
ерес Bamans. Our Behavior and Shape Society
and then the devilry begins
Devil1
devilry "€
Devil3
Devil4
What are [devils]? Are parasites devils?
Anonymous (ID: 6 Ey) = 09/27/21(М0п)18:39:06 No.341161329 » >>341161567 : 320px-Lambton Worm.jpg (68 KB, 320x465)
=
Be >-341160425 >Lambton worm >https://en.wikipedia.org/wiki/Lambton_Worm >The story states that the young John Lambton was a rebellious character who missed church one Sunday to go fishing in the River Wear. In many versions of the story, while
walking to the river, or setting up his equipment, John receives warnings from an old man (or a witch — depending on who tells the story) that no good can come from missing church.
107
Could the word ‘devil’ be replaced with the word ‘parasite’ in all of the following verses without losing context?
Mat 9:32
Mat 9:33
Mat 11:18
Mat 12:22
Mat 15:22
Mat 17:18
Mar 5:15
Mar 5:16
Mar 5:18
Mar 7:26
Mar 7:29
Mar 7:30
Luk 4:33
Luk 4:35
Luk 7:33
Luk 8:29
Jhn 8:48
As they went out, behold, they brought to him a dumb man possessed with a devil.
And when the devil was cast out, the dumb spake: and the multitudes marvelled, saying. It was never so seen in Israel.
For John came neither eating nor drinking, and they say, He hath a d
Then was brought unto him one possessed with a devil, blind, and dumb: and he healed him, insomuch that the blind and dumb both spake and saw.
And, behold, a woman of Canaan came out of the same coasts, and cried unto him, saying, Have mercy on me, O Lord, thou Son of David; my daughter is grievously vexed with a devil.
And Jesus rebuked the devil; and he departed out of him: and the child was cured from that very hour.
And they come to Jesus, and see him that was possessed with the devil, and had the legion, sitting, and clothed, and in his right mind: and they were afraid.
And they that saw it told them how it befell to him that was possessed with the devil, and а/о concerning the swine.
And when he was come into the ship, he that had been possessed with the devil prayed him that he might be with him.
The woman was a Greek, a Syrophenician by nation; and she besought him that he would cast forth the devil out of her daughter.
And he said unto her, For this saying go thy way; the devil is gone out of thy daughter.
And when she was come to her house, she found the
And in the synagogue there was a man, which had a spirit of an unclean devil, and cried out with a loud voice,
And Jesus rebuked him, saying, Hold thy peace, and come out of him. And when the devil had thrown him in the midst, he came out of him, and hurt him not.
For John the Baptist came neither eating bread nor drinking wine; and ye say, He hath a devil.
(For he had commanded the unclean spirit to come out of the man. For oftentimes it had caught him: and he was kept bound with chains and in fetters; and he brake the bands, and was driven of the devil into the wilderness.)
Then answered the Jews, and said unto him, Say we not well that thou art a Samaritan, and hast a devil?
Jhn 8:49
Jhn 8:52
Jhn 10:20
Jhn 10:21
Jhn 13:2
Act 13:10
Eph 4:27
Eph 6:11
Heb 2:14
Jas 4:7
1Pe 5:8
1Jo 3:8
1Jo 3:10
Luk 9:42
Luk 11:14
Jhn 7:20
108
Jesus answered, | have not a devil; but | honour my Father, and ye do dishonour me.
Then said the Jews unto him, Now we know that thou hast a devil. Abraham is dead, and the prophets; and thou sayest, If a man keep my saying, he shall never taste of death.
And many of them said, He hath a devil, and is mad; why hear ye him?
Others said, These are not the words of him that hath a devil. Can a devil open the eyes of the blind?
having now put into S son, to betray him;
And supper being ended, the d the heart of Judas Iscariot, Sim
And said, O full of all subtilty and all mischief, thou child of the devil, thou enemy of all righteousness, wilt thou not cease to pervert the right ways of the Lord?
Neither give place to the devil.
Put on the whole armour of God, that ye may be able to
Forasmuch then as the children are partakers of flesh and blood, he also himself likewise took part of the same; that through death he might destroy him that had the power of death, that is, the devil;
Submit yourselves therefore to God. Resist the devil, and he will flee from you.
Be sober, be vigilant; because your adversary the devil, as a roaring lion, walketh about, seeking whom he may devour:
He that committeth sin is of the devil; for the devil sinneth from the beginning. For this purpose the Son of God was
In this the children of God are manifest, and the children of the devil: whosoever doeth not righteousness is not of God, neither he that loveth not his brother.
And as he was yet a coming, the devil threw him down, and tare him. And Jesus rebuked the unclean spirit, and healed the child, and delivered him again to his father.
And he was casting out a devil, and it was dumb. And it came to pass, when the devil was gone out, the dumb spake; and the people wondered.
The people answered and said, Thou hast a devil: who goeth about to kill thee?
What are [demons]? [devil = demon] In ancient times, what were [parasites] called?
Are demons considered clean or [unclean]? Are parasites considered clean or [unclean]?
Do demons get inside of your body? Do parasites get inside of your body?
Do demons manipulate your behavior? Do parasites manipulate your behavior?
Do demons take possession of your body? Do parasites take possession of your body?
Does fasting “cast out demons”? (M17.21) Does fasting “cast out parasites”?
Do demons try to make you commit suicide? Do parasites try to make you commit suicide?
Do Old Testament Laws prevent possession from demons? Do Old Testament Laws prevent possession from parasites?
Why do the infected use ‘they/them’ as pronouns?
Who is the Gerasene demoniac? (L8.32)
["My name is Legion, for we are many"]
After the worms were exercised, what did they infect next? Will parasites kill the host in order to continue its life-cycle? Do worms have a history of drowning their hosts?
Spinochordodes tellinii is a parasitic nematomorph hairworm whose larvae develop in grasshoppers and crickets. This parasite is able to influence its host's behavior: once the parasite is grown, it causes its grasshopper host where the grasshopper will likely drown.
Family: Chordodidae Genus: Spinochordodes Kingdom: Animalia Species: S. tellinii
What happened to the swine?
Were the pigs possessed by demons?
Or were the pigs possessed by parasites?
Is the word 'parasite' synonymous with the word 'demon'? 109
Got a little out of my comfort zone and wore an outfit that had been hiding in my closet for a year. It was so much fun <2
Ф Bean ses? (they/them xe/xem)
ID in captions
Could a demon be "cast out" of a host by administering anti-parasite treatments?
"Seek, therefore, a large trailing gourd, having a stalk the length of a man; take out its inwards and fill it with water from the river which the sun has warmed. Hang it upon the branch of a tree, and kneel upon the ground before the angel of water, and suffer the end of the stalk of the trailing gourd to enter your hinder parts, that the water may flow through all your bowels. Afterwards rest kneeling on the ground before the angel of water and pray to the living God that he will forgive you all your past sins, and pray the angel of water that he will free your body from every uncleanness and disease. Then let the water run out from your body, that it may carry away from within it all the unclean and evil-smelling things of Satan. And you shall see with your eyes and smell with your nose all the abominations, and uncleannesses which defiled the temple of your body; even all the sins which abode in your body, tormenting you with all manner of pains. I tell you truly, baptism with water frees you from all of these. Renew your baptizing with water on every day of your fast, till the day when you see that the water which flows out of you is as pure as the river's foam. Then betake your body to the coursing river, and there in the arms of the angel of water render thanks to the living God that he has freed you from your sins. And this holy baptizing by the angel of water is: Rebirth unto the new life. For your eyes shall henceforth see, and your ears shall hear. Sin no more, therefore, after your baptism, that the angels of air and of water may eternally abide in you and serve
D "- HELF QUICKNAY арм. OPTIONS мер BLUE LETTER BIBLE | an Verse or Word(s) La CLICK TO CHANGE
Pf ~ « < Y > » "coPY COPYOPTIONS E STRONG'S FORMAT BY: & VERSE (Х/ PARAGRA
Rom 7:20 Now if | do that | would not, it is no more | that do it, but sin that dwelleth in me.
Does sin "live" inside the body? Is the word 'sin' and the word 'parasite' synonymous?
Q & kingjamesbibleonline.org/2-Maccabees-Chapter-9/
9 бо that the worms rose ир out of the body of this wicked man, and whiles he lived in sorrow and pain, his flesh fell away, and the
filthiness of his smell was noisome to all his army. 2 Maccabees 9:9 KJV verse detail
Do demons come from hell? Is hell underground? Do worms come from underground? Mar 9:48 Where their worm dieth not, and the fire is not quenched
Іп 2012, in response to Günter Grass's poem "Was gesagt werden muss" ("What Must Be Said") which criticized Israel's nuclear weapons program, Israeli poet and Holocaust survivor Itamar Yaoz-Kest published a poem entitled "The Right to Exist: a Poem-Letter to the German Author" which addresses Grass by name. It contains Е If you force us yet again to descend from the face of the Earth to the depths of the Earth — let the Earth roll toward the Nothingness." INTE Tae journalist Gil Ronen saw this poem as referring to the Samson Option, which he described as the strategy of using Israel's nuclear weapons, "taking out Israel's enemies with it, possibly causing irreparable damage to the entire world."[34]
Why would a jew [an infected] claim he does not want to return to 'underground'? [depths of the Earth]
Do worms come from underground? What did the ancient Greeks call the 'underground'?
What is Sheol? |
It gets worse.
111
сеп 3:14 And the LORD God said unto the serpent, Because thou hast done this, thou art cursed above all cattle, and above every beast of the field: upon thy belly shalt thou go, and
Do serpents eat dust?
[Dust of the Earth = dirt]
Do serpents eat dirt or do worms eat dirt?
Can the Latin term 'serpens' be translated into the English terms ‘snake’, 'dragon' ог 'WORM'? Is the Serpent from Genesis actually a worm?
a" ре ere HELP QUICKNAY ADY. OPTIONS pus Lodi it cia mms KN. « < ¥ > » СОРУ COPY OPTIONS Ш STRONG'S FORMAT BY: «Әуезе (OJ PARAGR)
Lev 15:19 ‘| And if a woman have an issue, and her issue in her flesh
be blood, she shall be put apart seven days: and whosoever toucheth her shall be unclean until the even.
Why does the Bible consider menstruation to be unclean? Can [unclean] parasites be transmitted through blood?
Why does the Bible consider nocturnal ejaculations and sex to be unclean? Can [unclean] parasites be transmitted through semen?
o тт HELP QUICKNAY ADY. OPTIONS Im JE LETTE IBLE ; a» runc CO KIV,
7» = « < ¥ > » COPY COPYOPTIONS Ш STRONG'S FORMATBY: Verse (©) PARAGI
Deu 23:10 If there be among you апу man, that is not clean by reason of uncleanness that chanceth him by night, then shall he go abroad out of the camp, he shall not come within the camp:
Deu 23:11 But it shall be, when evening cometh оп, he shall wash himself with water: and when the sun is down, he shall come into the camp again.
Lev 15:18 The woman also with whom man shall lie with seed of copulation, they shall both bathe themselves in water, and be unclean until the even.
112
Why does the Bible consider pork and shellfish to be unclean? Are pork and shellfish notorious parasite vectors?
жа BLUE LETTER BIBLE = pape Ter | ІРІ KJV
CLICK TO CHAN
« < Y > » ЯСОРҮ COPYOPTIONS Ш STRONG'S FORMAT BY: NERSE (S) PARAC
Lev 11:7 And the swine, though he divide the hoof, and be clovenfooted, yet he cheweth not the cud; he is unclean to you.
HELF QUICKNAY ADY. OPTIONS A BLUE LETTER BIBLE 3 KJV
Verse or Word(s KJV >» CLICK TO CHAN /
4 < ҰЯ» » COPY COPYOPTIONS Ш STRONG'S FORMATBY. Q/VERSE (S) PARAC iN Nh 7
Lev11:12 Whatsoever hath no fins nor scales in the waters, that shall be an abomination unto you.
Why does the Bible say sodomy is an abomination? Are homosexuals riddled with parasites? Is anal sex one of the most common methods of parasitic infection?
ums ж
Lev 18:22 Thou shalt not lie with mankind, as with womankind: it /s abomination.
What does the Bible say about drinking blood? Does consuming blood transfer parasites?
m HELF QUICKNAY ADY OPTIONS
ae BLUE LETTER BIBLE нини ІРІ KJV
CLICK TO CHANI
4 < Ж > » соғу COPYOPTIONS Ш STRONG'S FORMATBY. © VERSE [S) PARAG
Lev 17:10 ! And whatsoever man there be of the house of Israel, or of the strangers that sojourn among you, that eateth any manner of blood; | will even set my face against that soul that eateth blood, and will cut him off from among his people.
Are some yeasts considered to be parasites?
Anonymous ID:woIY6ACk Sat 12 Oct 2019 23:07:53 No.229679032
113
Why did the Bible consider mildew to be unclean? Is mildew a parasite?
Leviticus 14
33 The LORD said to Moses and Aaron, 34 “When you enter the land of Canaan, which I am giving you as your possession, and | put a spreading mildew in a house in that land, 35 the owner of the house must go and tell the priest, 1 have seen something that looks like mildew in my house.’ 36 The priest is to order the house to be emptied before he goes in to examine the mildew, so that nothing in the house will be pronounced unclean. After this the priest is to go in and inspect the house. 37 He is to examine the mildew on the walls, and if it has greenish or reddish depressions that appear to be deeper than the surface of the wall, 38 the priest shall go out the doorway of the house and close it up for seven days. 39 On the seventh day the priest shall return to inspect the house. If the mildew has spread on the walls, 40 he is to order that the contaminated stones be torn out and thrown into an unclean place outside the town. 41 He must have all the inside walls of the house scraped and the material that is scraped off dumped into an unclean place outside the town. 42 Then they are to take other stones to replace these and take new clay and plaster the house.
43 "If the mildew reappears in the house after the stones have been torn out and the house scraped and plastered, 44 the priest is to go and examine
it and, if the mildew has spread in the house, it is a destructive mildew; the house is unclean. 45 It must be torn down—its stones, timbers and all the plaster—and taken out of the town to an unclean place.
46 "Anyone who goes into the house while it is closed up will be unclean till evening. 47 Anyone who sleeps or eats in the house must wash his clothes."
Job 2:7. 1 So went Satan forth from the presence of the LORD, and smote Job with sore boils from the sole of his foot unto his crown.
Job 7:5 My flesh is clothed with worms and clods of dust; my skin is broken, and become loathsome.
Are animals considered spoils of war?
So why would God command Saul to kill all of the animals of the Amalekites? Were the Amalekites a nation of sorcerers?
Is magic associated with parasites?
If the Amalekites and their animals were infected, would God's command make complete sense?
m 7 22 z AD NS "X aa BLU E LETTER BIBLE Verse or Word(s) ІРІ KJV
CLICK TO CHAN(
« < ¥ > » E COPY COPYOPTIONS Ш STRONG'S FORMATBY: Wrerse (© PARAG
114
And Jesus milked an ewe which was feeding among the grass. And he put the milk upon the sand made hot by the sun, saying: "Lo, the power of the angel of water has entered this milk. And now the power of the angel of sunshine will enter it also."
And the milk became hot by the strength of the sun. "And now the angels of water and of sun will join with the angel of air." And lo, the vapor of the hot milk began to rise slowly into the air.
"Come and breathe in by your mouth the strength of the angels of water, of sunshine, and of air, that it may come into your body and cast out the Satan from you."
And the sick man whom Satan tormented did breathe within himself, deeply, the rising whitish vapor.
"Straightway will Satan leave your body, since for three days he starves and finds no food within you. He will come out of you to satisfy his hunger by the hot steaming milk, for this food finds favor in his sight. He will smell its smell, and will not be able to resist the hunger which has tormented him three days already. But the Son of Man will destroy his body, that he may torment none else again."
Then the sick man's body was seized with an ague, and he retched as though he would vomit, but he could not. And he gasped for air, for his breath was spent. And he fainted on the lap of Jesus.
"Now does Satan leave his body. See him." And Jesus pointed to the sick man's opened mouth.
And then they all saw with astonishment and terror that Satan was coming out from his mouth in the shape of an abominable worm, straight towards the steaming milk. Then Jesus took two sharp stones in his hands and crushed the head of Satan, and drew out from the sick man all the body of the monster which was almost as long as the man. When the abominable worm came out of the sick
"For I tell you truly, evils and dangers innumerable lie in wait for the Sons of Men. Beelzebub, the prince of all devils, the source of every evil, lies in wait in the body of all the Sons of Men. He is death, the lord of every plague, and taking upon him a pleasing raiment, he tempts and entices the Sons of Men. Riches does he promise, and power, and splendid palaces, and garments of gold and silver, and a multitude of servants, all these; he promises renown and glory, fornication and lustfulness, gluttony and wine-bibbing, riotous living, and slothfulness and idle days. And he entices every one by that to which their heart is most inclined. And in the day that the Sons of Men have already become the slaves of all these vanities and abominations, then in payment thereof he snatches from the Sons of Men all those things which the Earthly Mother gave them so abundantly. He takes from them their breath, their blood, their bone, their flesh, their bowels, their eyes and their ears. And the breath of the Son of Man becomes short and stifled, full of pain and evil-smelling, like the breath of unclean beasts. And his blood becomes thick and evil-smelling, like the water of the swamps; it clots and blackens, like the night of death. And his bone becomes hard and knotted; it melts away within and breaks asunder, as a stone falling down upon a rock. And his flesh waxes fat and watery; it rots and putrefies, with scabs and boils that are an abomination.
And his bowels become full with abominable filthiness, with oozing streams of decay: and i i have their habitation there. And his eyes grow dim, till dark night enshrouds them, and his ears become stopped. like f all shall the erring Son of Man lose life. For he kept not the laws of his Mother, and added sin to sin. Therefore, are taken from him all the gifts of the Earthly Mother: breath, blood, bone. flesh, bowels, eyes and ears, and after all else, life, with which the Earthly Mother crowned his body.
115
Protocol master 03/12/22(Sat)13:23:22 Мо.31249983 LJ b: 3982437435 ае4с064е88 b.jpg (149 KB, 1024x683)
>>31249889 >No need to get defensive The devil prowls around like a lion, looking for people to devour.
But the time is coming where there can be no more doubt. The wheat is being separated from the chaff and the lukewarm in spirit will be cast into the fire alongside the chaff.
>| was practically an atheist before cleansing The black goo and the parasites are demonic in nature. They suppress spirituality. Fill your thoughts with darkness, and torture you. They incite you to sin and make you feel iredeemable when you give in.
Sin, of which, is only such a strong temptation because of the inner uncleanness. These parasites are literal demons.
People need to know the truth, even if most choose to reject it. Not many will do what it takes. Water fasting is challenging. Doing coffee enemas appears emasculating. Taking a mineral powder sounds like woo-woo.
Now what if | told you all three of these thoughts are demonic in nature? The parasites are intelligent. They fear their annihilation and can alter your perception to keep you in a cycle of misery. Many people you meet are, in fact, possessed
If parasites are literal demons, and if parasites can enter a host through sex, and if parasites can take years before they seize control over a host, and if your wife was not a virgin when you met her, then could the following horror story not only be possible, but also quite commonplace:
СА Steve
Horror story concept: you fall in love with a woman, get married, and have a son. Shortly following your
Forty-nine days
— How long did the Buddha fast? forty-nine days The Buddha seated under the HELF uic v À n
| BLUE LETTER BIBLE — ee Rajayatana tree had been fasting for forty-nine days by then. They brought rice cakes
ER and honey to help him break his fast.
« < Y > » СОР COPYOPTIONS Ш STRONG'S FORMAT BY: < vensE (SN) PARAC
Then was Jesus led up of the Spirit into the wilderness to be tempted of the devil.
Mat 4:2 And when he had fasted forty days and forty nights, he was afterward an hungred.
22229657155 I've put serious thought into this in the past. In the bible it is written that (paraphrasing) "Jesus went out into the wilderness for 40 days during which time he did not eat for the entire 40 days in order to do cast satan out" Starving oneself is a very old method of dealing with parasites. If you arent
eating food then the parasites dont get to eat either and it comes down to they die out or you do.
Did the ancient Chinese believe that parasites are demons? What are Gu Demons? LINK What is a wetiko?
Like a trans-dimensional plague, It is simultaneously my personal tormentor and a metaphysical virus that has spread around the
world..infecting and feeding upon most, if not all, human beings
alive today.
Three Corpses
From Wikipedia, the free encyclopedia
The sanshi =P "Three Corpses" or sanchong = "Three Worms" аге a Daoist physiological belief that demonic creatures live inside the human body, and they seek to hasten the death of their host. These three supernatural parasites allegedly enter the person at birth, and reside in the
three dantian "energy centers", respectively located within the head, chest, and abdomen.
After their human host dies, they are freed from the body and become malevolent ghosts.
The pernicious Three Corpses/Worms work to harm their host's health and fate by initiating Sicknesses, inviting other disease-causing agents into the body, and reporting their host's transgressions to the gods. The Three Corpses are supposed to keep records of their host's misdeeds, ascend to tian "heaven" bimonthly on the night of Chinese sexagenary gengshen AQ Æ "57th of the 60-day cycle" while the host is sleeping, and file reports to the Siming 2195 ( T "Director of Destinies" who deducts a certain number of days from the person's life for each lf. N misdeed. One way of avoiding this bureaucratic snitching is to stay awake for the entire 55% gengshen day and night, thus preventing the Three Corpses from leaving one's body (a belief
- : cee Ва Sanshi =P "Three Corpses” illustration from the 5 later assimilated into the Japanese Koshin BF tradition). ja
(c. 9th century) Chu sanshi jiuchong baoshengjing E& For a Daoist adept to achieve the longevity of a xian "transcendent; immortal", it was ЕРЛӘНЕ
necessary to expel the Three Corpses from the body. Since these evil spirits feed upon
decaying matter produced by grains being digested in the intestines, the practice of bigu “abstinence from grains and cereals" is the first step towards expelling them. Bigu alone will not eliminate the Three Corpses, but weakens them to the point where they can be killed with waidan
alchemical drugs such as cinnabar, and ultimately eliminated through neidan meditation techniques. pu A" Food Pyramid
“Since these evil spirits feed upon decaying matter produced by grains..." Fin, voguna cheese —— Neat, EN нА ( Б 2-3 Servings
grains => |
* A feeling of pressure in the head, chronic migraine type headaches, weakened vision, poor hearing, unusual phantom
Peng Ju Possession Symptoms
smells and tastes, blotches and abnormalities upon the skin of the face, excessive amounts of mucous or spontaneous flowing of fluid from the eyes, bad breath
Peng Jiao Possession Symptoms
* Digestive issues, weakness in the back and knees which limits mobility, weakness and cold in the lower abdomen due to damage to the lower Dan Tien, nocturnal emissions, excessive feelings of desire and lust, addictive behaviors
Peng Zhi Possession Symptoms
e Pain and swelling in the chest and hypochondriac region of the body, shortness of breath, spasms in the body, an obsession with sensual pleasures, depression, suicidal tendencies 117
The location of the three worms also corresponds to three key locations upon the body which practitioners of alchemical meditation will be more than familiar with. These locations are known as the three of the key ‘clipping passes’; areas of difficulty for those involved in Daoist meditation.
The Peng Zhu clipping
pass known as Yu Zhen ^
The Peng Zhi clipping - pass known as Shen Dao
The Peng Jiao clipping
pass is within the sacrum Anahata chakra (Heart) Thymus gland Manipurana chakra (pancreas) Adrenal gland Swadhisthana chakra (Testis & ovary) ы “ Gonads gland
What are Chakras? Muladhara chakra Prostate & Chakras? = Glands? (Grounding & physical stemina) ^ Fallopian tube
Do parasites harvest gland secretions? By controlling human gland secretions, can a parasite control the human? Why does the worm coil up the kundalini?
What is the Caduceus?
COSMIC ENERGY ENTRY COSMIC ENERGY INPUT (FEMALE) (MALE)
vampire channel
Entities with a trunk B and suckars
Snail with
organs of the hola
G6 “There are beings in the spiritual realms for whom anxiety and fear emanating from human beings offer welcome food. When humans have no anxiety and fear, then these creatures starve... If fear and anxiety radiates from people and they break out in panic, then these creatures find welcome nutrition and they become more and more powerful. These beings are hostile towards humanity.
118
Hollywood has convinced you that demons have claws, horns, fangs, poison, and look like this:
...Well, ummm, for once, | guess Hollywood’s depiction was actually very accurate.
Cat-Demon takes possession of a man by inserting worm into man’s anus
130 Detail of man near the top of the
% decorative column mentioned in the caption for Figure 129, showing how the demonic tendril is inserted into the man's anus
The tendron from the demonic terminates in the body of the human figure.
Do parasites feed on human blood? What does pop culture mean by this:
"You're up my anus" "| drink their blood." LINK
Osculum infame
From Wikipedia, the free encyclopedia
Osculum infame is the name of a witch's supposed ritual greeting upon meeting with the Devil. The name means The Shameful Kiss, or The Kiss of Shame since
it involved kissing the devil's anus, his other mouth.
According to folklore, it was
a 9 і Тһе osculum infame illustrated іп this kiss that allowed the Francesco Mana GUazzo's Devil to seduce women. Compendium maleficarum of 1608
The pamphlet provided the first descriptions of the osculum infame to the English population?! Belief held that the Devil demanded the kiss of shame in forms other than human, including rams, black cats, and toads. Errores Haereticorum, a medieval tract, claims that the
131 The role could also be Why do witches have black cats?
reversed whereby the witch was the recipient of the kiss.!5] What is Toxoplasmosis? Modern version of Osculum Infame: LINK
What are "Generational Spirits"?
Are they passed from generation to generation?
Can parasites be passed from generation to generation?
What is another name for Generational Spirits?
What are witches’ cats called?
Can demons possess non-human mammals?
Can parasites infect non-human mammals?
Can those parasites allow the Hive Mind to communicate to humans through the host animal? What are "familiars"?
Wy
What is Stranger Things?
Did the Parasite begin by infecting animals [familiars]?
Did the Parasite use the infected animals to infect humans? When the Parasite infected Billy, did the Parasite gain control over him?
Did the parasite use Billy to spread more parasites to others?
121
Did the cravings of the infected hosts begin to change? Did the human hosts begin to crave the taste of feces?
Elements of history disguised as fiction?
Why is Homosexuality so protected? If humans are infected with parasites, could the parasites influence the hosts to crave feces? Is feces-consumption one of the most commons way to transmit parasites?
Over several weeks, the parasites migrate through host tissue and develop into adult worms inside the blood vessels of the body. Once mature, the worms mate and females produce eggs. Some of these eggs travel to the bladder or intestine and are passed into the urine or stool.
CDC - Schistosomiasis - Disease ша www.cdc.gov/parasites/schistosomiasis/disease.html
Little Crawlers
dude's finger on /b/ after fingering his girlfriends ass. also posted a photo of them on his tongue
Malte Mueller
Do jews have a scat fetish? LINK
Why would the government be so slow to put an end to this:
AUSTRALIA Home | U.K. | U.S. | News | World News | Sport | TV&Showbiz | Femail |7777 Science
doctors claim in a lawsuit against the government in a bid to wipe fecal matter from our food
* The government maintains a ‘zero tolerance’ policy on feces in food
* The Physicians Committee for Responsible Medicine says that only applies to ‘visible’ fecal matter
“ They filed a lawsuit against the USDA on Tuesday calling for tighter regulations
==) Bill Gates @ - @BillGates
| drank water made from human feces.
According to a Sunday op-ed in The Times, Sir James Bevan writes that "drinking recycled sewage is the future."
RESTAURANTS
Fecal bacteria found in drinks at UK branches of McDonald's, Burger King and KFC
M EDT | UPDATED THU, JUL 20 2017-8:21 AM EDT
PUBLISHED THU, JU David Reid Se f 9 in mà &DAVYREID73
UP NEXT | Shark Tank 7:00 PM ET Listen
Б found in ice at McDonald's, КЕС and Burger King in the U.K.,
levels were found et Burger King and KFC. TRENDING NOW
a make it
fa" LIFE BREAKING NEW. ; let + Ls Wendy's pe To “Pooping” чыз Whati rh e drinking in Chili For Over 2 Years [44 MSNBC | water? If you live in one of ——— N these states, it might soon be recycled sewage Published Fri, Aug 19 2022 12:12 PM EDT
Annika Kim Constantino Home | U.K. | News | The Queen | Sports | U.S. Showbiz | Australia | Femail 7 s @ANNIKAKIMC
Latest Headlines | Monkeypox | Covid-19 | CDC | WHO
Big Muck! Investigation finds FAECES on every McDonald's touchscreen unit
Share f Y
+ Touchscreens are used before eating food, often without washing hands “ The samples also found traces of bacteria that can cause blood poisoning
+ Expert at London Metropolitan University said findings are worrying
By VANESSA CHALMERS HEALTH REPORTER FOR MAILONLINE PUBLISHED: 09:21 EDT, 28 November 2018 | UPDATED: 11:21 EDT, 29 November 2018
123
Is your roommate gay? = = NEWSLETTER MkzniCcALNEWSTODAY
. Fecal matter found on more than 60% of toothbrushes in shared bathrooms
Sharing a bathroom with other people can have its downfalls — wet towels all over the floor, toilet seats left up, and that person who never replaces the toilet paper. But a new study finds there is one communal bathroom issue that is much more pressing: fecal contamination on toothbrushes.
explains study author Lauren
Aber, a graduate student of Quinnipiac University in Hamden, CT.
r/Coprophiles ujpa 57d
© NSFW
Breath after swallowing shit ? What is Coprophagia?
15 Coprophagia caused Бу a parasite? What is Giardia? What is Isospora?
I've a question guys; after swallowing a lot of poop, does your breath smell like poop? Вс I've tried to smell myself and | never smell like poo, but If it does; how much does it take to disappear, after brushing your tongue and teeth?
Qs Ом
d) BEST COMMENTS v
e dd «58d
| always brush my teeth when I've eaten ,| love having а solid piece in my mouth for a while then swallowing it hole with some water ,| also the after taste when | burp much later reminding me of my kinky fetish
ӘҢ SReply <p 2
ё 1550 + 1550 • MP · 155d
Оої man that's awesome, | found a tutorial of a sexy дігі that gives u instructions in what to do to begin to eat and wow jt man actually worked so damn good ,
Award
11; Share
Put the following videos on your list of things not to watch. They were included only to prove these demon parasites can really change people into something that is no longer human.
days ago | couldnt even eat a little piece and LINK1 yesterday | ate a BIG turd with no water ! Or anything ae it was amazing | ate а lot of shit and І came while I LINK2 did it was amazing LINK3
fa © QU
124
So this orgy was a piss orgy thrown by some friends. Even though it wasn't officially affiliated with it, it was advertised as a “Pre Wet n Hot” orgy, Wet n Hot being a big piss kink event that happens іп Palm Springs. It was what brought me to PS the first time | had visited
BabethePigBoi Sx 18t
It’s starting to sink in now. | screw my courage to my goddamn sticking, place (literally) and reach down and feel around my hole. And there it is, little bumps on the inside of my fucking ass cheeks. І had the pox
July 18
events in my life kept me from attending since 2015. So when 2020 came, I was
I've been attending Wet & Hot since 1999, skipping a year here and there but
eager and ready to resume......but that part’s history. So when this year rolled around, I was determined to get back to the inner pig I know I ат.
This weekend was ‘on fire’ The hottest sex I think I've ever had, not only based on previous years, but THE hottest sex ever. Laying in a sling. Guys pissing on me while I'm getting a dick up my hole, ecstatic pleasure feeling my hole getting flooded with piss and sperm. Feeding my piss to hungry pigs. Then the rush of watching groups of men feeding each other piss. Just letting all the restrictions and frustrations of the last 2 years take a back seat to the hottest, raw, breeding I've ever experienced. Once things got going, everyone seemed hard wired for shameless, anal and oral sex. The atmosphere was electric and I allowed myself to have the kinkiest raw man to men sex where the only thing that mattered was the greedy piss-hungry mouths and holes, craving to be fucked and filled, wallowing in pure ecstasy. I'll definitely be back next year. And to our first timers, a new world of piggy sex has just opened its doors for you. Each year I've come back I was able to shed some more inhibitions until I became a pure bareback cumslut and piss lover. I'm betting you first timers
just found a new avenue of pleasure. See you all next year.
g sheldon (lance on facebook) july
BOIS!! what an amazing time!! From the moment of arrival till the end of the event, what a glorious event. Thank you to all the organizers, volunteers, and event space for all you do to make this event crazy wild and memorable. The hottest moments for me this year was at barracks for the beer bust on Sunday. Wandering around in my diaper for 4 hours while many guys pissed into it, back and front, soaking it well beyond its capacity. Then to the hottie who graciously accepted the soggy diaper in his face while we made out, and the crowd watched, that was really stunningly fun!!! (if you read this, please message me Ө ) Making out with Ben and Jack at different times in the pool was stunning as well, Thank you Bois. The sensuality and peace was really needed and so much fun, Loved all the touches and kisses. Thank you Next year I want to try and stay at CCBC and do some volunteer shifts, I think for year #4 for me me would be a good time for me to start giving back to this wonderful community. Thanks for all the piss, Sexy Peeps!! For all the guys reading these reviews, jerking off to these reviews and not really believing this is all true, IT IS! It is true, x 10. Get
your fantasies and sexy bodies down to Palm Springs for Wetnhot #26
Pissy hugs
Derek july 19, 2022 at 8:21 pm
I started attending Wet and Hot in 2009 and its been one of the highlights of the year for me. I just love the feeling of brotherhood of being with literally hundreds of men who appreciate the glory of piss. After having to miss out of WNH for two years because of the pandemic and with the ever present worries about new Covid variants, plus now monkeypox - I wasn’t sure what to expect, but WOW what а great weekend. I literally drank quart after quart of piss and pissed up so many guy's asses, I lost count. I also really appreciated having “rimseat row” where guys who are heavily into eating ass could hang out. I always tell people that the piss scene seems to attract by far the friendliest, attitude-free group of guys. I've been to FF events and its no where near as welcoming an atmosphere as Wet and Hot. I'm
already counting down the days until next year!
Stewart Kramer July 1
Always a great event! The organizers do a great job, and there are so many hot guys with good attitudes. I only wish I could have stayed hydrated a little more
in all that heat, so I could give back a few more piss loads.
g Danny july 2
I wasn't sure what to expect so I figured Га go with the flow...get it? And I did get it! I snagged one of the rooms at CCBC a opened up due to a cancellation. It really is like winning the lottery. I rarely ventured outside of CCBC the whole weekend, working my way around the compound one drenching at a time. I found so many guys willing to gulp down my piss that I was constantly in refill mode so I could provide. I fucked and sucked and rimmed and got all of these pleasures in return. It took me a little while to go from yellow shorts to jock strap to nothing, but the heat and the friendliest guys made it happen. I made some new friends and connections that have been hard to make in the past few years. I found my tribe and
we pissed together. Looking forward to doing it again next year!
$ Steven ји
First time at WetnHot and I had the time of my life. I was оп the fence about
0 pm
going for a while, but I finally decided to buy the weekend pass about a week before the actual event. I had no idea what I was going to be getting myself into, but the tone was set for me at the barracks on Friday during the registration party! First time getting pissed on while I had my clothes on in a bar and it was soo hot! That scene
got me super horny and I was in the play area all night long that night!
I met so amazing pigs that I am very much looking forward to meet next year. And got drenched in piss at the barracks during beer bust while I was in nothing but vans
and a jockstrap.
I will definitely be returning next year to collect more piss and meet more making
piggies! Until next time!
g Tod Carrig July 19, 2022 at 1:01 am
My first wetNhot was in 2019. Returning for more piss-tastic encounters with sexy men from all over & making new friends definitely surpassed the slice of
heaven that was my first party. Can't wait for next year!
What is blood libel?
Gf) FORDHAM UNIVERSITY
Jewish History Sourcebook: Bernard Lazare: Antisemitism: Its History and Causes, 1894
Throughout the Middle Ages the Jew was considered by the common people as the magician par excellence, As a matter of fact, a number of Jews did devote themselves to magic. We find many formulas of exorcism in the Talmud, and the demonology both of the Talmud and the Kabbala is very complicated. Now it is well known the blood pla Chaldean magic, it was of the utmost consequence; in Persia it was considered as a means o a delivered all those who submitted themselves to the practices of Taurobolus and Kriobolus. The Middle Ages were haunted by the idea of blood as they were haunted by the idea of gold; for the alchemist, for the enchanter blood was the medium through which the astral light could work. The elemental spirits, according to the magicians, utilized outpoured blood in fashioning a body for themselves, and it is in this sense that Paracelsus speaks when he says that "the blood lost by them brought into being phantoms and larvae." To blood, and especially to the blood of a virgin, unheard of powers were assigned. Blood was the curer, the redeemer, the preserver; it was useful in the search for the Philosopher's Stone, in the composition of potions, and in the practice of enchantments. Now it is quite probable, certain, in fact, that Jewish magicians may have sacrificed children, and thence the genesis of ritual murder. The iso acts of certain magicians were
Stnbuted to them in ther character as Jews. It was maintained that the Jewish religion which approved of the
АР 27,2022 | [ENTERTAINMENT]
Why is blood associated with magic? Why is sex associated with magic?
In November 1909, Crowley and Neuburg travelled to Algeria, touring the desert from El Arba to Aumale, Bou Saáda, and then Dà'leh Addin, with Crowley reciting the Quran on a daily раѕіѕ 1911: 186-202 During the trip he invoked the thirty aethyrs of Enochian magic, with Neuburg recording the results, later published in The Equinox as The Vision and the Voice. Following a mountaintop БЕЙ magic ritual, Crowley also performed an evocation to the demon Choronzon іпуомпо Дваспісе, and considered the results to be a watershed in his magical career ??!
What are magic potions?
More specifically: what are put into potions to make them magic? What can be transmitted through blood and semen?
Are parasites used to create the ‘magic’?
What happens in Antarctica, stays in Antarctica. Or does it?
Ok guys, that my post as you will. | have been refraining from posting this for sometime, even back in the older days of antartica on /x and /pol several years ago.. | figure now is a good time as any. | stopped myself from posting because | feared gangstalking, or being traced, if there was any truth to what | am about to post. Now | just think fuck it, this post will most likely go unnoticed anyways and gang stalking is just an irrational fear for myself.
My knowledge of Antarctica comes from my best friend of 50 years now. Though we grew up together, we grew up in very different conditions. He was part of the rich family, who owned one of the largest factories in
my home town. | was the opposite, just a naive kid playing around town when we first met. We were best friends then, and | still consider him my best friend now, despite him traveling around the world, going to Princeton, and doing whatever he wanted.
The point is, he is a 31st mason and has lived a life way beyond | can imagine. despite all this, he always come to visit, sometimes several times a year, sometimes not for years.. but when he does, we usually get smashed and trashed, hookers blow, even he brought me dmt and other crazy shit. ok enough back story, time for the goods.
this comes Um him, his story hasnt changed, though he only told me this roughly 5 years ago and told me shit would be happening in less than a decade.. this starts with religion, and at first | rolled my eyes, but as he talked more it sent shivers up and down my spine.. so the masons have been in charge of controlling and releasing information to the public at reasonable levels (that is what he told me the majority of his masonic duty entails). and the first piece of media they altered was the bible.. a major part of the bible was cut out from the Revelations, revealing where the anti-christ and the beast would emerge from. he said the section they cut out was the most important.. cont limit reached
22102292333
wow scary trips.. kek is listening..
ok, so the revelations stated that the last anti-christ would be the total opposite of Jesus, spreading disease from an old age which turned most humans into zombies, or some weird shit he said.. anyways, he said this anti-christ was trapped in a frozen wasteland with magnificent buildings and was being held captive by KMs of ice.. he doesnt know exactly if this is an individual, even the masons think it is a virus of somesort. the bible didnt specifically state.. but he said, this is where the saying comes from ‘when hell freezes оуег. hell is already frozen over.. once hell is defrozen, then real hell will be unleashed..
he told me these temples in Antarctica have been explored by a group of people in control in the government, the same group of is doing crowd control methods all around the world, have been digging hoping to find this anti christ burried in Antarctica because some believe it is the key to immortality.. for another small section of the bible did refer to the everlasting life (garden of eden) being hidden right beside this anti-christ.. and in order to bring about the last days, it had to happen anyways.. so teams have been digging, blowing up shit, covering up, stopping visits (though he said you can visit the outside portions of Antarctica, only those who know will ever get to see those temples), and constantly destroying any information leaked from this expedition...
he told me, several years ago some russian thought he found a portion of the immortality and injected himself with an ancient virus they discovered in a vial in one of the temples.. he even cringed when talking to this story and said the guy instantly turned blue and froze over. everyone ran out and when they returned his body was gone (now they only work in those giant radioactive suits).. he said they had to replace him with a body double to avoid drawing notice or someshit in his real life.. cont. limit again
22102293121
he went into great detail about how big and complicated those temples, and he calls it a big giant city, expand across the entire continent. he said from one temple where you enter there are hundreds of rooms, hallways, traps, all types of symbols and shit on the walls, large books of ancient text no one can read, vials upon vials of random liquids which they cant even remotely identify but he said most contain living organisms in these vials, and they protected behind large traps shit from indiana jones.. he said theyve already lost over 500 people exploring and now they are using robots, but shit is so complicated you have to move blocks to open doors, solve riddles.. i dont know, he said its truly a giant mouse trap.. there are keys and legends on the walls, and a single room can contain up to 100 different keys for solving to open a trap... its crazy shit and they have the smartest people working on it, and they send in 3rd world people to go open the doors when they think they solved it.. its shit i still dont know what to make of.
so some other stuff he told me.. most movies and books are representing what they think will happen when it is discovered.. like transformers (with the frozen bot forget his name), all these zombie movies, and all this other shit in the media..
nonymous (10: (@NG75HXD) [+1 12/10/16(Sat)09:42:06 No.102294702 - >>102294965 >>102295026 >>102295174 >>102295482 >>102295567 »»102295662 >>102295862 >>102295945 >>102296936 >>102297023
>>102294030 just for you anon.. i will type out everything i know
he said game of thrones (one of the only shows i watch so i can relate to what he said), shows what they think will happen when they discover this antichrist.. they aren't sure it is, but the white walkers are meant to get normies ready to fight against the possible zombie out break.. and why they think it is soon, a quote һе kept repeating from the bible was, ‘after the war of wars, and after the winter of winters’ is when everything would happen.. he think the war of wars was from WW2 up until now, non stop fighting across the earth.. and the winter of winter refers to the ice of antartica decreasing and opening up parts of island still frozen..
another crazy fact he said they know, is there will be Jesus’ or Christ, right beside the anti christ.. and you will get to choose when it first discovered.. he think it will be two vials beside each other and you will have to drink one.. after the russian they put in a ban from ingesting any shit from these temples to prevent anything from happening.. its truly a cluster fuck of arguements because everyone wants to be the first to keep discovering, but they are in disagreement of what to do with all these random vials they keep finding.. he said each other has random living organisms inside of it and its bacteria and viruses we have never seen before.. shit which makes apple rot in minutes and monkey explode diarrhea and shaking to death.. but the coolest thing he said was there is a frozen giant skeleton in golden armor in one of the temples holding the skull of giant reptile (which looks to be over 30 feet tall (the giant), and the reptile head is roughly the size of a уап.. its incredible to see and unbelievable.
127
Mind-control Parasite Sex Magic: Do you remember back in 2016 when the President of Korea admitted to being mind controlled by a Cult of
Shaman Wizards who were trying to turn everyone into trannies?
> Anonymous <*> 10/27/16 (Thu) 07:34:06 ID: ас20се No.11085987 >>11025001 >>11088005 >>11088008 >>11085013 »»110260!8 File (ise): 8се298083902226... 1р9 (16.58 KB. 316x283, 316:263. madotsyki panic
tw this aintanime plot 1S THIS THE REAL LIFE? IS THIS JUST FANTASY? GOOGLE ‘CHOI SUN SIL’, | AIN'T EVEN JOKING HAHA I'VE HAD ENOUGH
‘It’s actually a system where Choi Sun-sil tells the President what to do’
http://english.hani.co.k'arti/english, edition/e national/767405.html
http://www.straitstimes.com/asia/east-asia/troubling-revelations-about-seouls-shadow-president-the-kcres-hersld-columnist
South Korean President Park Geun Hye releases a statement of apology to the public during a news
conference at the Presidential Blue House in Seoul, PHOTO- REUTERS
NTERNATIONA
Swirling Scandal Involving Shamanistic Cult Threatens S. Korean President
F
Former Mir Foundation official says power broker Choi received detailed а п мен presidential report almost daily, апа led meetings on governance And the ties are interesting, indeed. Choi Soon-sil is the daughter of a man the Behind-the-scenes power broker Choi Sun-sil received and reviewed 30 cm-thick “Presidential repot || president considered her mentor, Choi Tae-min. He claimed to be a pastor from a tiny packets” from the Blue House on a nearly daily basis until as recently as this spring, a witness recently a е " S З а ы pseudo-Christian sect, but а leaked diplomatic cable from the U.S. Embassy describes him as a 'Rasputin'-like character and his "church" is described by Korean media as
more of a "Shamanistic cult." The New York Times explains further:
"Mr. Choi was the founder of an obscure sect called the Church of Eternal Life. http: Awww. npr org/sections/thetwo-wsy/20 16/10/28/49986491 5/swirling-scandsl-involving-shamanistic-cult-threstens-sxorean-president
! Anonymous (ID: 62% %87) == 10/28/16(Fri)02:38:52 No.94885324 P> >>94885473 >> 757
What is known about this 8 Goddesses group? Any ideas as to their beliefs or goals?
Anonymous 10/28/16 (Fri) 08:41:57 ID: 4b942f No.8001039 >>2001071 >>2001115 >>8001293
»»8001006 Anonymous (ID: CETIS) == 10/28/16(Fri)02:40:44 No.94885473
- £12 choi sun sil - #0102 ABE hyundai group(not hyundai car) File: june-bday-wide.png (282 KB, 488x318) 2294885324
-CJD 01012 CJ group -235 SHS xp 201 SAIS wife of deputy minister of Culture, Sports and Tourism - Зр 21S 8 2] S*?! wife of hanhwa group owner 13 their main goal is to turn men into women 27169 +201 wife of industrial bank owner 01212 wife of famous lawyer CIL SERI ЫРА 279 governor of korean red cross
128
Honey bees communicate through chemical/pheromone emis- — : - . ence, one of the significations of the presence sion as well as with dance symbolism. So, what if all the weird (оғ the beehive among the symbols of Masonry
clothing choicesand hand signals which public figureheads ex- may be construed as a symbol of leadership vo . of its Master, and the storing up of wisdom, hibit during broadcasts are actually the parasites themselves knowledge and light, represented by the honey
trying to give or request specific instructions? of initiation,
The bee represents “the hive mind” meaning they are all groomed to protect the hive. They do what it takes to protect the hive.
They tell us in many ways.
The elite love Sodomy above all else. Why, anyway? Not a Scrooge McDuck gold coin bath, or blowing up a priceless artifact because they can? To paraphrase Sam Hyde (Can’t find the original quote) “You’re an evil FBI agent and the worst you can muster is to rape some kid? OOOOOH! So scary! How about try to blow up the moon, or make a bunch of animals go extinct if you love evil so much?” Could it be the reward center of their brains are so messed up by the worm, that butt stuff is a higher pleasure than anything to them?
Scottish Rite
Compared to the three degrees in standard freemasonry, the Scottish Rite, an offshoot of Freemasonry, has 33 degrees . Thirty of these degrees are “appendant
degrees”, in that they are not higher in ranking but lateral. This means that a member with a 21st degree in the Scottish Rite has the same ranking as someone with the 3rd degree of masonry.
pubmed.ncbi.nlm.nih.gov/676277€
The temperature profile of the pathogenic yeast Candida albicans
M Lemos-Carolino, A Madeira-Lopes, N Van Uden
PMID: 6762776 DOI: 10.1002/јобт.3630221004
Abstract
A strain of Candida albicans was found to have an associative temperature profile with respect to growth, thermal death and yield on glucose. The ARRHENIUS plot of sustained exponential growth displayed two branches in the supraoptimal temperature range with ti growth around 552 C, the final maximum temp: the initial r 1m temperature for growth around 42
optimum temperature for
endent in the supraoptimal range and
optimum and the initial maximum temperature for growth.
What is Spirit Cooking? Does it involve the consumption of blood, raw flesh, and feces? What organisms are found in blood, raw flesh, and feces?
NOTHING TO SEE HERE, JUST A BUNCH OF ULTRA RICH PEOPLE HAVING DINNER AT A TABLE OF A MOCK HUMAN SACRAFICE
130
Q The New York Times ©
Fed up with online harassment from conspiracy theorists, the performance artist Marina Abramovic breaks her silence about the treatment she's faced. "I need to open my heart. | really want to ask these people, 'Can you stop with this?"
e
Marina Abramovic Just Wants Conspiracy Theorists to Let Her Be
Keith369.. жеңеді for truth ©kKeith359 і тубат
The ебат isn't the treatment she faced, it's the
treatment her and her followers subject other
people to.
Lia
3 more replies
1 сасна wobbystarbuck > 6l IP " ytim * Nah iu em sick person, your 'art" is free to
be and should be criticized.
не reply
(o The —— (Save pinned post) ©The n -
anytimes
"Artist"
The StrayWolf (Save pinned post) (211 € » Dont be afraid to show her art then
"666" (bottom left) and an upside-down star. This doesn't help to stop the theories
Conclusion: the “workers” are predominately those who call themselves ‘jews’, but they also include many other people who have likewise become possessed by parasites which now manipulate or control their body. These “workers” are likely unaware they are being controlled and assume their wants and desires are their own. They can usually be identified by their behaviors, particularly their fierce devotion to the jews and the collective’. If a “worker” was infected during their developmental years, then he will often display identify- ing facial malformations (such as the jewish nose, knobby knees, narrow eyes, an aptitude for baldness, etc).
It can take many years for a host to progress from human, to NPC, to possessed, and for this reason, the par- asites prefer to infect children. Many poisons and toxins have been put into our environment in order to speed up this transition.
However, any individual who becomes too powerful or influential is brought into the fold through various more extreme methods, most often relying on the consumption of parasitic larva by means of magic potions and spirit-cooking events.
In the past, these parasites were called demons, devils, spirits, and sin, and the same techniques which were historically used to exercise a demon from a human host can also be used to remove a parasite from a hu- man host. Although these exorcisms can cure the infected, often there remains lingering and irreparable damage to the host's brain and body.
Just as with the demon at Gerasene, these “workers” are merely victims, themselves, and are being con- trolled against their will by the parasites which has infected their body. These workers are not the true ene- my, but they must be treated as such due to the immediate danger they pose to the uninfected.
131
7. THE DRONES
Who are the drones? How much debt exists in the world?
IMAGES SHOPPING
9,010,000,000 Results Anytime ”
Ф 8 4& 45 (4%)
BANK OF CHINA (HONG KONG)
©
CONFIRMATION LETTER
AS DULY AUTHORIZED OFFICERS OF BANK OF CHINA (HONG KONG) LIMITED. WE HEREBY CONFIRMED WITH BANKING RESPONSIBILITY THAT THE ACCOUNT HERE
National Debt by Country
NOVEMBER 1, 200 UNITED STATES
OESCRIBED IS AUTHENTICATED, FREE AND CLEAN OF ORIGIN FROM THE ACCOUNT О ANY TAXES IMPOSED THE DUTIES OF ANY NATURE, AS IMPOSED BY ANY GOVERN: AUTHORITIES.
PREVIOUSLY BANK ACCOUNT NO. BANK ACCOUNT NO. 34 ;$11-AM 1. WAREHOUSE RECEIPT NO. C-3 10 UP TO 31 10 U.S.D. ACCOUNT NO. 61-1 '85/081-11 '85
AMOUNT U.S. $ 2, 180, 000, 000, 000, 000.00 U.S.D.
18021 23388
$152 trillion
Global debt is at record highs, amounting to $152 trillion or 225 percent of global GDP (Chart 1). Close to $100 trillion or about two thirds are liabilities of nonfinancial firms and households-— private debt. The remainder is public debt.
,
(TWO QUADRILLION, ONE HUNDRED EIGHTY TRILLION U.S. DOLLAR)
UPDATED UP TO BALANCE SHEET WITH INTEREST AS OF NOVEMBER 1, 2007
TOTAL OR U.S. $ 2, 590, 058, 000, 000, 000.00 U.S.D.
Who owns this debt? Root of all evil?
DEPOSITOR FR. JOSE ANTONIO DIAZ ALIAS SEVERINO STA. ROMANA SOLE OWNER / SIGNATORY TIBURCIO VILLAMOR MARCOS RESTRUCTURED JANUARY 2, 1986
MATURITY AUGUST 11, 2009
WE FURTHER CONFIRM THAT THE SUBJECT ACCOUNT COVERED BY SWIFT CODE NO BKCH CN BJ 66593777 AND POST CODE-MCD 1008818 TLX 22254 BCHO CN.
Гето бууу Tun i
CHAIRMAN VICE-CHA}
BANK OF CHINA BANK OF CHINA
ivar Orn Heimisson
Since | was a kid and realise that parasites exist, | have wanted them all destroyed. Complete parasite eradication of the planet should be a top priority. The fact that this is not the case makes me theorize that the elites are actual parasites in more than just Eating behavior.
Have you heard of any of these names?
How does one become a drone? What is the basilisk?
Pliny the Elder describes the [Basilisk]:
1. Snake-like creature
2. Not more than 12 inches long
3. Power to kill
4. Power is associated with the eye
"To look directly at a basilisk meant certain death"
[Medusa]:
A creature associated with snakes [worms]. Small, 12 inch long worms protruding from skull. Has the power to kill through the eye.
[Baylisascaris]:
Shaped like a snake.
Small, 12 inch long.
Has the power to kill through the eye.
@ cdc.gov/parasites/baylisascaris/index.html
CDC Centers for Disease Control and Prevention
CDC 24/7: Saving Lives, Protecting People™
Parasites - Baylisascaris infection
Image: Left: Embryonated B. procyonis egg, showing the developing larva inside. Right: Larva of B. procyonis hatching from an egg. Center: Raccoons are hosts for the roundworms that can cause Baylisascaris infection. Credit: DPDx, U.S. Fish &
Wildlife Service [4
If a parasite needs to influence a host's cognitive abilities, where would it most likely be found in the body? What major organ of the central nervous system directly connects to the optic nerve? Does the drone parasite enter a host through the mucus membrane of the eye?
133
“и David Szymanski @
was an evolutionary reason to be afraid of something that looked human but wasn't.
Picture of someone about to be droned by a Vril Type 1 Lizard.
The Vril type 1 lizards (terrestrial aliens) are parasitic, carnivorous and malevolent. They dwell underground. They’re dumb but smarter when they turn a human into a host (drone). They have a proboscis (called the Quill) located on top of their head. The proboscis (which looks-like a chocolate chip) contains everything that the lizard is (it's consciousness). Their lizard body is dead once the proboscis leaves its body. They can only do this once in their lifetime and if they fail (turning a human into a host), they die. The victim that is about to be bodysnatched parasitically is unconscious or restrained. The proboscis enters the victim's eye and spirals around the optic nerve. It then proceeds to go to an area of the brain (driven by taste) that tastes like butterscotch to them. Then, they do a feeling of holding your breath and pushing outwards. Finally, it does what's called Sweating the Quill (at the tip of the proboscis), which excretes the parasitic cells that take over the human body. This kills the person and replaces their consciousness with the Vril's lizard's consciousness. The Vril lizard becomes that human (after some recovery time).
This transition from Vril lizard to human is what's called Droning. Also, this transition is what is referred to as demonic possession and shape-shifting. Once a Vril lizard becomes a human, they are then known as a Drone, Host of VriLor a
Parasited Host.
(Eye of Horus)
ZZ
Worm
ж
| am the WORM you сап never delete. September 11th, 2015
134
Can parasites utilize mrna technology? Can mrna technology transfer memories? ale : : 3 i What is the Resurrection Chamber of Gilgamesh? ie . : : California sea hare study demonstrates Are parasites used to create immortality? memory transfer via RNA
Memory transferred between
Date: May 14, 2018 Source: Society for Neuroscience
Summary: | Memories can be transferred between organisms by extracting ribonucleic acid (RNA) from a trained animal and inject- ing it into an untrained animal, as demonstrated in a study of sea snails.
Share: f м Ф іп %
FULL STORY
Memories can be transferred between or- ganisms by extracting ribonucleic acid (RNA) from a trained animal and injecting it into an untrained animal, as demonstrated in a study of sea snails published in eNeuro. The research provides new clues in the search for the physical basis of memory.
[.] Anonymous 12/14/21(Тие)02:39:34 Мо.30505806 )» >>30505817 >>30505913 >>30533367 File: black-eye-club12.jpg (228 KB, 500х814)
>>30505789
Almost every (real) Elite you see has been alive for thousands of years, because they're an Archon hopping from shell to shell. Now here's the other crazy part, pic related. Their shell might start out with a human soul. For example Bill Gates really was Bill Gates when he was in his 20s, but then "they" came for him and inserted a worm into his eye which burrowed into his brain and took over. They do this to anyone who gets too important. This means Archons physically exist, in the form of a brain parasite.
Also, Stargate SG-1 was a military funded soft disclosure of the true nature of our reality, that sentient brain worms with thousands of years of knowledge are jumping into human shells and ruling us, and that the Egyptian Pharaohs really were these creatures, back then ruling us openly as gods.
Ancient Egyptian Temple in the city of Aswan
135
They have tried to convince you that reptilians look like this.
ANS MINN
Nis
[basilisk]-sized worm coiled around the host's pituitary gland
If the host dies, does that destroy the parasite? LINK
If a parasite can move from host to host, how long could the parasite live? Longer than the host?
How long do humans live?
What is MK Ultra?
What insect is used to represent MK Ultra?
How do Monarchs know the destination of their migration? How many generations does it take Monarchs to reach their destination? Do butterflies start as worms?
What is a [Monarch]?
СТЕ - rr
Portrait of Queen Elizabeth I
Not a snake. Is it something more like this: LINK
The painting today tist's originally looked
A mysterious image of a coiled snake has appeared in a 16th century painting of Queen Elizabeth I, the National Portrait Gallery has said.
The Tudor queen was depicted with the snake clasped in her fingers in an original version of the work, but it was replaced with a bunch of roses.
The paint has deteriorated over the years to reveal the serpent's outline.
The smiles of the drones:
Who is Huma Abedin? LINK
.. they are sus.
139
8. THE QUEEN What is the Hive Mind?
How does a queen bee control her hive? How does a queen ant control her nest? Always [female]?
How do radios operate? Is а single radio station able to control the sound produced by millions of individual radios? 15 the purpose of the parasite to 'set the host to the right radio frequency’?
What is Dollhouse? [Stop Loss 2.9] What is a neural radio? What is the Mind Whisper?
Truth disguised as Fiction?
140
Who is the Hive [Mind]?
What is a neural network?
Can an entire planet have a neural network? Earth’s [Mind].
Is the Hive Mind a sentient being? LINK
Is the Hive Mind a Fungus?
c Anonymous 1D: 2x23L25h Sat 12 Oct 2019 19:24 -
Quoted By: 22229670896
>toxoplasmosis
Professor theorises electrical impulses sent by mycological organisms could be similar to human language
Linda Geddes Science correspondent
» Wed 6 Apr 2022 00.01 BST
What is Cosmic Death Fungus? LINK1 LINK2
Anonymous ID:JDC2tq0i Sat 12 Oct 2019 18:56:30 No.229658108 = Report Quoted By: 722229663656
| Fats, Oils & Sweets USE SPARINGLY
Milk, Yogurt & Cheese Group 2-3 Servings
Meat, Poultry, Fish, Dry Beans, Eggs
& Nuts Group
2-3 Servings
Fungus
Fruits Group 2-4 Servings
Bread, Cereal Rice & Pasta 6-11Servings
Anonymous ID:ox/63Uo3 Sat 12 Oct 2019 19:40:00 No.229661850 == Report 22229661522
141
Father figure...
ti Toxic Masc @ Retweeted
Poz Breeder @PozBreeder
Pet worm... My fave pig | knocked up and who | still breed just found out he knocked up his first bottom bitch. My strain lives on. #poz #gifted #bbbh
9:03 РМ · 26 Mar 14
7 Retweets 32 Likes
% Larry Hewes & @Poz4Chasers · 2d
Replying to @PozBreeder
Congratulations on your new "grandson"! So glad to hear that his "father" is still toxic. Are you still toxic? And are any of you 3 guys interested in being Gifters? There are a hundred chasers for every Gifter globally. | am glad to refer all Gifters to chasers in their area.
Tweet your reply
142
Who is the real enemy? (Eye of Horus) Always [female]? Who is the Queen of Heaven? (J44.19)
[Mystery, Babylon the Great, the Mother of Prostitutes and Abominations of the Earth]
"You shall not make for yourself an idol, or any likeness of whatis in heaven above or on the earth beneath or in the water under the earth. Exodus 20:4
MUI i^
пт
yl Ш
hed a MIN Tii OE. di
dams s. di = Білді eee elene — ivioon Gi
зе! Oddess Greco-Roman marble statue A.D.
E E
Attis was a Phrygian god of the Sun and born of a virgin. He bled to death
after castrating himself in order to
transition into a female moon goddess.
| am Inanna, Queen of Heaven On my way to the East
Her cult was deeply embedded in Mesopotamia and among the Canaanites to the west. F. F. Bruce describes a ТЗ ШЕТШЕ А ЗЕЕ ТЕТ [STR ORE CIE Cu ETSI 207922 by the
Akkadians. He links Ishtar, Tammuz, Innini, Ma (Cappadocia), Mami, Dingir-Mah, Cybele, Agdistis, Pessinuntica and the Idaean Mother to the cult of a great mother goddess. "8!
Rod of Asclepius Caduceus
144
What is the Ouroboros? Hexagram of Satan
/ оға tle
One ring to rule them all. pwrwiwverinne i е One ring to find them. A Наар Опе ring to bring them all.
lease And in the darkness bind them.
/
% ш/ту/ Му
қ J) Ale е
Г tamm.
Astarte [edit]
The goddess, the Queen of Heaven, whose worship Jeremiah so vehemently opposed, may have been possibly Astarte. Astarte is the name of a goddess as known from Northwestern Semiti regions, cognate in name, origin and functions with the goddess Ishtar in Mesopotamian texts. Another transliteration is "Ashtart; other names for the goddess include Hebrew mnwy (transliterated
Ashtoreth), Ugaritic ttrt (also ‘Attart or ‘Athtart), Akkadian DAs-tar-tü (also Astartu) and Etruscan Uni-Astre (Pyrgi Tablets) According to scholar Mark S. Smith, Astarte may be the Iron Age (after 1200 BC) incarnation of the Bronze Age (to 1200 BC) Asherah 119]
с Mark 5 i Astarte was connected with fertility, sexuality, and war. Her symbols were the lion, the horse, the sphinx, the dove, and 7171919 indicating the
sc planet Venus. Pictorial representations often show her naked. Astarte was accepted by the Greeks under the name of Aphrodite
What was the Medusa?
Was Medusa female?
Was Medusa a Queen?
Snakes for hair or snake-heads?
Who is the Parasite Queen of Heaven?
— p" |— ы — ШЕГІ! DNE RESISTANCE BUILD, e WHICH 15 IDEAL 2 FOR SPEED RUNS. THIS IS S0 SCK. KS ace” ee mere 25, 4 > =. cy А Wee? EE Was : | [ І
147
9. TRUTH AS FICTION
Rik Lesel
Well, much of that is actually this little talked about method of the elite. It follows the requirements of i iversal law which requires
в a a a — THE ELITE'S DO TELL US THROUGH THEIR BOOKS AND PUBLICATIONS, MOVIES AND NEWS RELEASES WHAT THEY ARE DOING - THIS IS CALLED REVELATION OF THE METHOD. IF YOU ARE TOO STUPID TO RECOGNIZE IT FOR WHAT IT IS THAT IS YOUR PROBLEM FROM THEIR POINT OF VIEW. IT IS A FORM OF RITUAL MOCKING OF THE VICTIM.
1 1
When truth is presented as fiction you are lulled into a "it's just SciFi" mindset. It's not their fault, they told you--you are just programmed to beLIEve it's all SciFi. The Parasites behind the curtain and their "Jaffa" even tell you who to blame. The WEF, The Rothschilds, the "elite". Those things are "fronts". Do you honestly beLIEve the real baddies sign their own names? THEY LIVE is a
documentary.
OMiCRON.
CEU eire, АДЫ
Pee £d C С
1963 movie OMICRON An alien takes over the body of an Earthman in order to learn about the planet so his race can take it over.
What is Adrenochrome?
« Fringe
52.Е9 < All episodes >
Snakehead
Episode aired Dec 3, 2009 - 42m
Drama Mystery Sci-Fi
148
How do you identify them? [emotions]
tottion 42
Къл
The entire, uncut novel ÆJ
Imagine small worms taking over a host’s central nervous system! Good thing it is just science-fiction!
Why were the Goa’uld kicked out of 109 star systems
\
by the Asgard?
ТЕГ
What is a Mind Flayer?
What is the Infection Carrier? [2005] LINK What is Borrelia burgdoferi?
How does Lyme disease become chronic? LINK [Infection Carrier]
View Same Google iqdb SauceNAO Trace & tapeworm-parasite-similar-to-nep (...).jpg, 123КІВ, 960x551 Anonymous ID: 2t54bdEN Sat 12 Oct 2019 21:08:06 No.229669575 = Report
bump.
149
Imagine if people could actually
become addicted to fast food?
What would you do for something you need so badly that if you cannot get it, you die?
He who controls the spice controls the universe.
AZ QUOTES
Why assassinate doctors? Why assassinate biologists?
WE ARE OF PEACE. ALWAYS.
THEY ARRIVE
Interesting neck... LINK1 LINK2
TUESDAYS 8/7c 9%, абс start here
WATCH A BNEAK PEEK AT ABC.COM/V
What did HULU mean by this? LINK
PUBLIC SERVICE ANNOUNCEMENT
BROUGHT TO YOU BY JAMES DASHNER
Help stop the spread of the Flare. Know the symptoms before you infect your neighbors and loved ones.
The Flare is the virus Flarevirus (V3FLR), а highly contagious manmade infectious disease Flarevirus was originally created as a biological weapon, protected under government sanction, and held in secure facilities in the Southern area of the former United States of America, The virus was released during the Sun Flare Catastrophe because of massive damage to its Quarantined location
The Flarevirus causes a progressive, degenerative illness of the brain, resulting in uncontrolled movements, emotional distur- bances, and mental deterioration The result has been the Flare pandemic.
“Алу Suspicious Subyects
AR WARNIN
Scientists are in Clinical. trials, but there is no standard treatment for the Flare at this time. The virus is generally lethal, and has been documented as ап airborne contagion.
At this time citizens must unite to prevent further spread of this pandemic. By learning how to recognize yourself and others as Viral Contagion Threats (VCTs) you will take the first step in the battle against the Flare.“
The incubation period averages 5 to 7 days, although the onset of symptoms and the severity of those symptoms vary greatly. Aides have been dispensed to ай major cities to help identify VCTs. You
ate stage
Should be reported immediately to the authorities
INCE
can recognize these individuals by their red shirts and medical badges. Seek them out if you Suspect yourself or someone else of infection
Al! government entities have adopted a zero-tolerance policy for dealing with VCTs, Any attempt to hide or conceal symptoms or those exhibiting symptoms will be met with severe punishment. Any discovery of usage of mind- numbing pharmaceuticals to mask symptoms will result in swift and immediate consequences. Any VCTs to report themselves will be treated humanely.
WARNINI Muscle spasms * Disorganized and/or aggressive speech
* Auditory hallucinations * Severe paranoia * Dementia Sudden aggression Self-mutilation
History
After the Sun Ра this wiki меу and came to
conclude that only
ofy 9"
population would have enough resources for
Search all wikis e remaini
e Coalition searched for a means of population control The Flare
living. Fearing war and civil unrest, |: hat would eliminate large numbers of people quickly and as humanely as possible was discovered by Katie McVoy, a scientist of the Post-Flares Coalition after she researched
the biological weapons that AMRIID had in containment. McVoy believed that the disease
151
Do the infected realize they are infected? Do the infected believe their actions are their own?
Alien Intruder: A game of deception, aliens, and paranoia.
Instructions: Alien Intruder is a game played by 6 to 15 people. One player acts as Game Master and one player assumes the role of Hive Mind. The remaining players are Scientists on a Research Mission. (Total Players / 6) of the Scientists are secretly Alien intruders.
Hive Mind: The Hive Mind is the puppet master pulling the strings of deception. The Hive Mind knows who the Aliens are and who the Scientists are. This player observes the game and tries to manipulate the Alien Intruders to eliminate all the Scientists. The Hive Mind wins if 3/4 of the Scientists have been eliminated before completing all of their Tasks.
Alien Intruder: This player does not know they are an Alien intruder. For all intents and purposes the Alien Intruder(s) thinks they are normal Scientists.
Scientists: The Scientist's job is to survive and eliminate the Alien Intruder(s) or complete all tasks. The Scientists do not know who the Alien is. The Scientists win if the Alien(s) are dead or if they have completed all of their Tasks.
ile (hide): -::.png (760.86 KB, 455x658, 65:94, Dostoevskij.png) (h) (u)
On the sidelines, re-reading the novel "Crime and Punishment" by Dostoevsky, | came across this passage in the last pages - very curious because, even if imagined 155 years ago, it seems to adapt quite well to today's everyday
Was that what you were aiming for?
Fyodor Dostoevsky Crime and Punishment, 1866 - (Pevear & Volokhonsky Translation)
He had dreamed that the whole world was doomed to fall victim to some terrible, as yet unknown and unseen pestilence spreading to Europe from the depths of Asia.
Everyone was to perish, except for certain, very few, chosen ones. Some new trichinae had appeared, microscopic creatures that lodged themselves in men's bodies. But these creatures were spirits, endowed with reason and will. Those who received them into themselves immediately became possessed and mad.
But never, never had people considered themselves so intelligent and unshakeable in the truth as did these infected ones. Never had they thought their judgments, their scientific conclusions, their moral convictions and beliefs more unshakeable. Entire settlements, entire cities and nations would be infected and go mad.
Everyone became anxious, and no one understood anyone else; each thought the truth was contained in himself alone, and suffered looking at others, beat his breast, wept, and wrung his hands. They did not know whom or how to judge, could not agree on what to regard as evil, what as good. They did not know whom to accuse, whom to vindicate.
& ° Achan
e | C Greater Socio-Political Wormoid Theory General Anonymous (ID: tnokoARf) 09/30/21 (Thu)15:51:15 No.341575738
You were issued a warning! ; ; File: 1633031475132 jpg-(164 KB, 1400x700, OCFEFF23-9110-4660-8132-2(...).jpg)
You were issued a warning for posting >>>/p0l/341575738. ; EX |5 Disney/Pixar's "Inside Out" soft disclosure for the
: ; : қ hidden Wormoid empire? Off-topic; all images, debate, and discussion should be
current events. Off-topic threads should be posted оп /|
Your warning was issued on September 30th, 2021. The пате you were posurig wiui was Anonymous. In addition to heeding this warning, please review the rules and FAQ.
Now that you have seen this message, you should be able to post again. Click here to return.
152
KA NAMA KAA LASER AMA
г DO NOT MAKE: ^ SPERCEWITH, WORMS):
free
H
hittps://files.cathox.moe/9rbtxh.patf hitns://pastebin.com/SqkPBxuy hitps://ghostbin.com/980Kl
* = >
штен тты
Parasites eat hormones Vitamin C deficiency 90% infections undiagnosed
^
FDA FOOD PYRAMID { y EQUALS WORMFOOD o A
Anonymous (ID
>>342231938 Ayear ago | ve e we are, on the cusp of y he evil and degeneracy that has been growing exponentially t ( / all operate the same. ТІ
VV] VV
hat if every theory we have about kikes doesn't tell the full story, and all of this is actually about parasites? What are the odds that our slavemasters are actually being controlled by advanced parasites that influence their behavior? It would sort of explain how kikes, trannies and shills seem to instinctively follow the same narrative and use the same tactics of subversion, almost to the point where it's supernatural. And it would explain how kikes have managed to keep their subversion shit going for centuries despite having no real leader or authority figure. Even your every day poorfag loser tranny shitposter uses gaslighting and subversion in ways that a normal person never would and would never think to. And they probably aren't getting orders from the elite kikes to post that way. It just seems unnatural, when | really think about it. | Know this is some real schizo spitballing, but the shills' absolute horror and fear concerning Ivermectin had me thinking about it. You can really tell the shills are scared out of their minds. | know that vermectin being a proven and effective treatment will eat into their profits, but their screeching seems out of proportion this time. It has me wondering if there are parasites out there so advanced that they almost have some kind of sentience that can push agendas through multiple generations. No other explanation has ever really explained how normal everyday people learn how to act like subversive kikes. Even my sister acts like a shill. | know a lot of it can be explained away by social conditioning but sometimes it just feels far fetched, especially considering how kikes have kept this game going for generations. The kikes who set this shit in motion aren't even alive anymore, yet they're going by the same playbook without missing a beat. can see why a lot of people seem to think they're literal demons, but I'm not very religious. At this point, if you have knowledge in the general occult, stuff like NWO, the real "reptilians" ЖТТ Т. РУЖ ancient history, you will start to see trends. Essentially, ‘parasites’ is the last piece that actually File (36 KB, 398x378) makes sense of the whole charade from beginning to end
n]
b > could be saved if we force feed the entire population mer/para onetlipills —9— simple all along and that s the BIG SECRET? So the whole plan was to use the medical sounds to ironic to be true , and yet i've heard more outlandish shit than this
industry to allow for prolonged parasitic infestations by only treating the symptoms, encourage sugar and an acidic diet to make sure the parasites enjoy their stay inside Anonymous ID:ER153vMb Sat 12 Oct 2019 21:00:31 No.229668923 us and also promote gay sex and open relationships so that they can spread to new a parasite just flew over my house hosts.
Pretty funny
that turned out to be true
E Anonymous (10: ФИКРРОН)) ЕН 09/1 File (73 KB, 8
THERFUCKER THIS WAS AN ANIME/WEEB THREA cal tendencies , | STARTED WATCHING THIS WEEB SHIT WITH VAMPIRES (and was enjoying it ) till yo faggy
fuck уо otherfucker you've opened а can of worms to big to ignore now
155
https://archive.4plebs.org/pol/thread/228145641 https://archive.4plebs.org/pol/thread/229657 155 https://archive.4plebs.org/pol/thread/336908730 https://archive.4plebs.org/pol/thread/338 156838 https://archive.4plebs.org/pol/thread/339152068
https://archive.4plebs.org/pol/thread/339641 184 https://archive.4plebs.org/pol/thread/3401 19307
https://archive.4plebs.org/pol/thread/340144974 https://archive.4plebs.org/pol/thread/340273967
https://archive.4plebs.org/pol/thread/340553112 https://archive.4plebs.org/pol/thread/340579847
https://archive.4plebs.org/pol/thread/340700972 https://archive.4plebs.org/pol/thread/340746087 https://archive.4plebs.org/pol/thread/340854654 https://archive.4plebs.org/pol/thread/340873041 https://archive.4plebs.org/pol/thread/340893512 https://archive.4plebs.org/pol/thread/340909892 https://archive.4plebs.org/pol/thread/340922339 https://archive.4plebs.org/pol/thread/340954193 https://archive.4plebs.org/pol/thread/34 1108506 https://archive.4plebs.org/pol/thread/341147625 https://archive.4plebs.org/pol/thread/34 1163823 https://archive.4plebs.org/pol/thread/341 177320 https://archive.4plebs.org/pol/thread/341 178156 https://archive.4plebs.org/pol/thread/34 1203079 https://archive.4plebs.org/pol/thread/34 1212408 https://archive.4plebs.org/pol/thread/341213370 https://archive.4plebs.org/pol/thread/34 1252068 https://archive.4plebs.org/pol/thread/34 1282105 https://archive.4plebs.org/pol/thread/34 1300962 https://archive.4plebs.org/pol/thread/34 1300993 https://archive.4plebs.org/pol/thread/341324147 https://archive.4plebs.org/pol/thread/34 1345186 https://archive.4plebs.org/pol/thread/34 1390519 https://archive.4plebs.org/pol/thread/34 1413067 https://archive.4plebs.org/pol/thread/34 1510958 https://archive.4plebs.org/pol/thread/34 1603938 https://archive.4plebs.org/pol/thread/341731608 https://archive.4plebs.org/pol/thread/342128558 https://archive.4plebs.org/pol/thread/342452507 https://archive.4plebs.org/pol/thread/342772366 https://archive.4plebs.org/pol/thread/342846288 https://archive.4plebs.org/pol/thread/344695548 https://archive.4plebs.org/pol/thread/345546445 https://archive.4plebs.org/pol/thread/345929629 https://archive.4plebs.org/pol/thread/346081078 https://archive.4plebs.org/pol/thread/3466 19609 https://archive.4plebs.org/pol/thread/346886501 https://archive.4plebs.org/pol/thread/347 083132 https://archive.4plebs.org/pol/thread/348065059 https://archive.4plebs.org/pol/thread/34981 1727 https://archive.4plebs.org/pol/thread/349917493 https://archive.4plebs.org/pol/thread/350480518 https://archive.4plebs.org/pol/thread/350795552 https://archive.4plebs.org/pol/thread/351 199742 https://archive.4plebs.org/pol/thread/351444387 https://archive.4plebs.org/pol/thread/353357 195 https://archive.4plebs.org/pol/thread/353396341 https://archive.4plebs.org/pol/thread/46140732
https://archive.4plebs.org/pol/thread/46 146968
"So basically the world is controlled by parasitic mind bending sentient worms. They spread through degenerate behaviour, which explains homosexuality, pedophillia, beastiality etc. There is historical evidence dating back thousands of years and the people in charge don't want you to know. The cure is really simple, just take some de-worming medication and wait a week."
156
ITS OKAY TO DE- WORM
D Anonymous (ID: 7253) [el 10/03/21(Sun)21:52:52 Мо.342014033 P >>342014217 >>342014288 >>342014316 >>342014320
(making my blog post here instead of a new thread) HOLY FUCKING SHIT YOU FUCKING FUCKS WHY WHY WHY FUCKING SHIT PISS FUCK FUCK NIGGER SHIT PISS
WHY DID I DO IT WHY THE FUCK DID I DO IT
»be me >got horse meds
>also got meds to give me liquid shit direrihha
>take both
>start shitting really hard
>like a fucking volcano outta my ass
>nothing in the first 3 eruptions
>wait about 10 min
>oh fuck feels like i got a log coming?
>go to shit
>spew it out HARD
>feel something long
>sweet relief.
>
>,
>feel something rubbing on my ass
>stand up
>a fucking tape worm
>a FUCKING TAPE WORM
>IT ALIVE
>THIS THING IS AT LEAST 2 FEET LONG
>ITS WIGGLING AROUND IN THE TOILET BOWL
>IT WAS TRYING TO GET BACK UP MY ASS
>SLAM SHUT THE BOWL
>FLUSH TOILET LIKE 10 TIMES
>CHECK
>ITS STILL IN THE TOILET BOWL
>HO-LEE-FUCK
>PUSH IT WITH THE TOILET PLUNGER AT THE FLUSH HOLE >FLUSH WHILE WRANGLING THE TURD WORM
>WORM IS FINALLY FLUSHED
>FLUSH ABOUT 20 MORE TIMES
>ALSO FLUSH BLEACH AND OTHER CHEMICALS DOWN MY TOILET TO MAKE SURE ITS NOT LURKING THERE FOR MY ASSHOLE >FLUSH ALL THE CHEMICHALS SO IT DIES
>PROBABLY ACCIDENTALLY MADE MUSTARD GAS IN THE PROCESS
WHAT IN THE ABSOLUTE FUCK
LJ Parasites Anonymous (ID: СИЕЗІ) 25 08/17/22(Wed)08:14:36 No.391455506 8) » >>391456196 >>391456591 >>391456662
Are these tiny fellas really influencing humans that much? Are their effects making an appearance within our politics or society?
Have you been down this path before and attempted to rid yourself of these? If so, any results?
D Anonymous (ID: ӨУ/ПЕЗІЗ)) = 08/17/22(Wed)08:15:30 No.391455592 >
| need the itchy ass remedy
Anonymous (10: (KERGBBEID) == 08/17/22(Wed)08:22:39 No.391456196 > >>391455506 (OP)
Cool it with the antisemitism.
Anonymous (ID: ЖШ) ҒА 08/17/22(Wed)08:27:00 No.391456591 > >>391456896 b: 1630143173143 jpg (94 KB, 1080x690)
22391455506 (OP)
as really ir
Bono, even the flu virus has зеза наета side effects to enhance its spread. Parasites are capable of much more advanced behavioral modification, the "n is if those changes are E e their effects j ап appearance w I the rumors of rampant degeneracy are true, they’ ve an entire biosphere of them, not just an ecosystem е you beer n this path befo nd attemp to rid yourself of these? If so, any re PUN works 8 тові. І take it quie аа | ja like eating sushi and tartare 1 make no excuses for this and know it's risky to consume food like this.
| don't crave sugar at all anymore (easy food for parasites). Thoughts are much less intrusive. | actually feel thirsty for water more often (low hydration extends time for eggs to hatch in gut). General well being is better as a result.
Given enough time, /pol/ will probably figure out how to get rid of parasites that are in extremely difficult to summon forth to kill, i.e. vertebrae, marrow, nervous system, muscular tissues. Gl parasites are oe easy targets. n your general wellbeir
j it take for t ng any differences 7 A tio rons for just deser а being, six for what it is now. Two series did it va me.
| did not always follow directions though. I'd frequently take around 3x-4x the recommended dose with no ill effects beyond a fever in the first week. Something just got instakilled in that instance, because parasites that die excrete their entire gut microbial load. They literally shit themselves when they die, because it promotes reinfection by any lingering eggs by inducing hatch conditions. That's why they recommend a 1 month series. Kill the adults, and kill the young when they're most vulnerable every time they
hatch.
E Anonymous (ID: 44%/ғедһа)) ЕЗ 10/31/21(Sun)18:33:56 No.345559815 > File: Attach53663 20211028 090033.jpg (553 KB, 1564x1564) rm ^C " 22345546445 (ОР) 22345559252 22345559275 Also, don't know if you guys have skin problems but a friend of mine has been struggling with scalp psoriasis for years. Here's a pic she sent me while going on the cleanse (wormwood/cloves/black walnut hull те» haay Wut tincture)
And a pretty strict diet of pineapple, raw pumpkin seeds, fresh garlic in hot sauce
159
File: 9098E283-695B-4482-892B-9(...).jpg (533 KB, 828x1364)
©) Ipol/ was right about deworming Anonymous (ID: EIZA) = 11/03/21(Wed)22:59:29 No.345999246 > >>345999754 >>346000128 >>346000442 >>346000544 >>346000559 >>346000620 >>346000643 >>346001258 >>346001560 >>346001665
>>346004429 >>346004696 >>346005069 >>346005083 >>346005146 >>346005153 >>346005280 >>346006228 >>346006550 >>346006732 >>346006868 >>346006920 >>346007043 >>346007402 >>346007927
| was а skeptic of the deworming threads, but thought Га give the Маск walnut, wormwood, anis, and oregano oil regimen a try given that I've had heavy brain fog and fatigue for years.
>Week 1: nothing happens
>Week 2: shitting 3-4 times а day full-size logs, stomach feels like it's boiling throughout the day (that mean’s it's working Imao)
>Week 3 night 2: farting uncontrollably and pissing off the wife, she yells and me to go to the can to get rid of them. | shit straight fire and feel something thin passing through the end of it.
>look into toilet bowl instinctively from last 2-3 weeks of checking stool >see 4-inch long roundworm floating there dead
>realize it's likely been in there for years, stealing my male vigor like a nigger in the night
>start hyperventilating about how much of life I've missed
Anonymous (10: QM) ШЕ 10/28/21(Thu)18:57:03 No.345202590 |» >>345202744 : asad.png (78 KB, 178x331)
been using the dog dewormer(pic related) for a week and my sugar cravings * porn addiction have completely vanished. | used to fap to trannies.
>>33026847 >dandruff is fungal Dandruff is lymphatic stagnation. Your body invites the fungus to help break down toxins that are sludging up your sewer system. Look up Dr. Morse ND on youtube.
The reason we need thousands of threads on this shit is because topical treatments don't work. You can't just kill the parasites/fungus/whatever or starve it. You have to take a dual approach.
#1 you have to stop eating tons of garbage (meat, grains, starches) that clog up your digestive system. If you don't do this they'll always have plenty of food. #2 you should stop eating in general. Juice or water fast in this time period. Remove all the fiber. Your body directly absorbs the nutrients and it starves any parasites. #3 take antiparasitics alongside. Nothing solid. Just tinctures. 1 lost 20 Ibs worth of hookworms, ropeworms, one or two tapeworms, and endless amounts of candida. l'm talking you're going for months and its STILL coming out. Did that with a juice fast. People who freak out or think they've made progress seeing a little bit of yellow shit in their stool haven't seen shit. You have to starve the fuckers, rehydrate the fuckers with juice/water, then dase d ee herbs. NOTHING else works. It must be done all together. And | am convinced that once you do it the PROPER way you will literally be superhuman compared to 99.99%
You will have to go through literal Hell to get there and | mean it. Absolute Hell on Earth. You'll feel like you're dying, like you should quit and give up. That's exactly what the parasites are banking on. They are demons. The worst stuff is black and smells like rotten eggs. Immediate relief when you get rid of that too. I've seen anons refer to it as the "black goo" and it's 100% real.
160
p021- 12-4 11 -21-3 32- cropped.jpg ( 46 KB, ‹
fi і Anonymous (10: GRMBOWVEAD) == 12/04/21(Sat)11:14:36 No.3507 Б» >>350733573 >>350734841 22350736103 >>350736387 >>350739332 >>350739349 >>350739753 >>350740003 >>350740487 >>350740833 >>350742128 >>350742601 >>350742611 >>350742800 >>350743085 >>350743216
utoimmunity 1 me g ant рг the recent nd nearly killed me tin h pericarditis and dial tamponade. At oint ek in a hc under inte jaws bloc ЕСЕ / around
what he did fi
) / ent me home the next c / ) back to oct hosp X for prednisone. you've ev hig f pred for а peido of time r the de t turns you into. In old folks hon y call її 1 vil's tic-tacs'. The only t y got close tc ming violent with p
ich | passed and found in my stool tod 5 te га could continue to live and
Anonymous (ID: GRMBOVEFA)) = 104/2 6:50 No.3 770 » >>350733223 >>350736387 >>350740833 le: 2021-12-4 11-19-17-cropped jpg (
1:3
went completely unmentic
and CREDIB rmer (cheap sub and it's time to fig ck. After all, ho
Anonymous (ID: CAM (Tue)12:06:51 No.342232244 » >>342232411 >>342232558 >>342235821 >>342237348 1633409542134 jpg (7 )
trol of me very strange ł pened to me. i ho wierd left I a ] a fu cked up bladder is out. feel like t C сопеа аго the optic
I've been after the parasites for months now. | pas a few here and there. The TURPENTINE and everything else you could do. I've had DE in the fridge for a while. Well | made a small safe protocol for myself of the ingredients on hand and I've had a aches in the upper turn of my colon for 6 ths. Yesterday and today without warning | let go of the colony.. Lots like in your pictures and 100s more of unidentified parasites including flukes and species of insects like pink grubs.
This evening | had a huge surge of energy along with rushes of anger. It's the die off and I'm so happy. Ә $. Show less
оу 109 ” &» REPLY
didiydi 4 yes Amazing Tom, congratulations! What is DE?
өз P REPLY
Tom Tutt 4
didiydi Diatamatios Earth is diatoms from the bottom of a dried seabed. comes in a powder I ordered 2 bags 5lbs each. for $20 with shipping. under a microscope the powders look like small beads with razor edges that will cut up anything it passes..Totally safe, | even use it around windows and doors for a non toxic bug killer. It works internally and externally.
dh 9 REPLY
iydi 4 yea Tom Tutt ah yes, | know about it, thank you. What was your daily/weekly routine than (times&quantities) if you care to write? | have a feeling your way will work for me. I've used turpentine in the past, so that bit | know. Just wondering what else to combine it with. Also, | did too many enemas in the past and it causes lazy colon so can't have too many of those and can't afford colonics at the moment. How often did you do enemas? Thanks Tom!
dó2 P REPLY
Tom Tutt
didiydi | kept it simple the only thing that took time was getting the correct Turpitine. | ordered Diamond G from Georgia.
3 days a week 4 sugar cubes with 1 Tsp turpitine dropped on the cubes. and eat them,. | TSP organic castor ой ог 1 frozen castor . | took DE 1 Tsp in a glass of water mixed it as well as possible. | only drank distilled water. while doing this 3 week protocol. | got results daily but not what | expected.
After Three weeks | just waited and drank distilled water.
Three weeks past and | started all over. and within a hour I got a pain and the results were proven. even the nesting sites past,. | was really surprised. That week | only ate a light diet and I sugar cube a week.
3 oreginol drops a week to kill any eggs left behind.
161
Anonymous (ID: 75АВоМлі ) E E 10/02/21(Sat)23:09:52 No.341855713 І» >>341856085 >>341857182 >>341857894 ile: 1633009844321 jpg (302 KB, 1000x1607)
ЕЕ 22341792228 (ОР)
I solved my 30-year long depression іп 12 hours with a single dose of horse paste. The biggest redpill T
is that it's always been about the worms.
Anonymous (ID: sKrymą5s ) 5% 10/02/21(Sat)17:40:21 No.341819907 P> >>341820172 >>341831807
ile: 1632972792149.jpg (460 KB, 1536x2048)
I just started 3 days ago with all this shit
garlic-tumerin-ginger-tabasco-chilli seeds mixtures to drink
black walnut wormwood and clovers
І never had such diarrheas | feel like im shitting out everything | have inside me like every 3 hours
but | must say
| never felt better
at first some headaches and stuff but literally the second day | started | wake up and | just feel so much better, lighter, brain fog gone and all that shit now | will do those memes and then do a 20 days fast while drinking apple cider and pumpkin seeds
/pol/ was a shithole but this wormpill opened my eyes and makes me see the world differently B
Anonymous (ID: -kMSESL4i ) ЕШ 10/02/21(Sat)21:14:46 No.341842958 |» 22341843848 >>341843893 5341844038 >>341844405 File: Wyrmpll.jpg (281 KB, 887x1701)
>no symptoms
>took the wyrmpill
>nothingburger
>mfw 12 days later
Anonymous 10: 3rsajc3f Sat 02 Oct 2021 21:27:57 No.341844405 ЕШ Report
>>341842958 Same here, the only symptom | had was farting a lot, but | never linked it even to the wyrmpill.
| did a 3 day ivermectin/mebendazole treatment (2x10mg ivermectin, 2x100mg mebendazole per day), while drinking a few cups of tansy tea here and there. Just to give it a try. | ended up shitting out dead worms.
I'm now convinced it is definitely a good idea to do this twice a year. | felt better afterwards too, my craving for booze is gone and | don't fart as much either.
>>341843136 Li Probably. A mild laxative is recommended just in case, as a sure-fire method. But if you're not constipated you're probably good to go with a cup of coffee.
Anonymous 1D:qyZzP7s59 Sun 03 Oct 2021 19:21:41 No.341958794 Bl Report
Quoted By: >>341959155 >>341959633 >>341960811 >>341967520 >>341971379 >>341971497 2201850167 same, і took garlic clove chewing + wormwood, black wallnut cloves and few more capsules, shit out small red worms after few days, the difference is 1000% if not more in how good i feel, sugar craving gone, porn craving gone, gay thoughts gone, can hyperfocus for 5000+ words reading in one go, sleep 100x better just as you said even though im a NEET and never leave house just by statistics of how many hands your food and packages go through paired with % of people (80-99%) infected with t gondii or other parasites its a guarantee everyone is infected due to interacting with other { humans }
View Same Google iqdb SauceNAO Trace $ wtfworms.png, 2MiB, 1538x2048
Anonymous ID: 6h9dtaoz Sun 03 Oct 2021 19:20:51 No.341958704 ЗЕ Report Quoted By: >>341963407 >>341970319 >>341970753 >>341971455 >>341973131 >>341975279
Porn does nothing for me now and candy is gross. | used to be addicted to sugar and now | don't give a shit. | used to take allergy medicine every day, sneeze 20x a day. Now | don't sneeze. | had to wear sunglasses all the time, the sun hurt my eyes. Now | don't need them. What the fuck! D
Anonymous Ір: дулр7550 Sun 03 Oct 2021 19:33:54 No.341960231 Bl Report Quoted By: >>341960703 >>341971715
22341959155
yeah i know, i doubted i had any type of parasites since i never go out at all, but then i shit them out after few days, then i started to think and look into statistics how many % of human pop has just ONE OUT OF 1000+ parasites that can infect humans, and its ~40-80% for t gondii depending where you live, its impossible to not be infected Since some nigger at the store never washes his hands while stocking up the product line * a lot of npcs put things back from their cart to shelves so all those hands touching the box can infect you. now add in all other possibilities like door knobs etc... even if you dont touch it or go near them other people do that touched those packages, its literally exponentional superspreading world disease that can only be defeated if you continuously deworm yourself
prophecy of Kt png PISKAN BRIS? Anti parasites cures everything Anonymous 10: 6h9dtaozZ Sun 03 Oct 2021 19:15:46 No.341958167 ШШ View Reply Original Report
Quoted By: >>341958581 >>341958605 >>341958794 >>341959407 >>341960211 >>341960339 >>341960477 >>341960896 >>341961377 >>341961459 >>341961487 >>341962599 >>341963594 >>341963973 >>341964425 >>341965585 >>341965657 >>341966548 >>341966560 >>341967167 >>341967417 >>341967507 >>341967639 >>341968407 >>341970011 >>341971646 >>341971943 >>341972033 >>341972445 >>341973449 >>341973479 >>341973484 >>341973851 >>341973987 >>341974059 >>341974105 >>341974223 >>341975279 >>341975677 >>341975989 >>341976221 >>341976250 >>341977104 >>341977574 >>341977706 >>341978155 >>341978282
кз Mon 27 Sep 2021 216 ж
"в also why Jenrses jimmes are so rustied and Аер purging the theeeds Alas the autism has been unleashed and there is no getting off tma ride These евз are fucking crazy ful of autism and scream of old /poV.
Candida, fatigue, allergies, sugar cravings, porn addiction, insomnia, eye strain, covid...is all gone because | took anti parasitic medicine. How the fuck is this possible? What does it mean when anti parasitic medicine cures most people's problems?
FROGS EAT WORMS FROGS EAT WORMS FROGS EAT WORMS
[406 / 121 / 160]
View Same Google 4032x3024
iqdb SauceNAO Trace $ 6261D0FA-ED39-4D9C-8DCD-1A890D21 (...).pg, 2MiB,
—— е 65
i "RT s
Anonymous 1D: 8VumbhAE Tue 05 Oct 2021 22:13:53 No.342261061 ЗЕ Report
Quoted By: >>342264512 >>342264665 >>342267766 >>342269320
C Anonymous (ID: (4УеВу2Ғ4:) = 10/06/21(Wed)11:08:47 No.342330180 >
Two years ago | started regularly deworming and taking vitamins, have since healed from being practically dead.
Anonymous (ID: 6042149) == 10/06/21 (Wed)13:40:12 No.342339818 >
| did a 3 day cleanse, not even with pharma and shit out all kinds of stuff. feel more energized and less foggy. more motivated even and I'm also noticing desire to reproduce when | didn't before.
My results seem to be very positive, after 6 days of cleansing (Cloves mixed with flax seeds and eating separately pumpkin seeds)
| feel lighter and | feel my sense have become sharper and more vibrant.
| also feel less urges to watch porn and | actually want to go outside, | also feel that my emotions are less apathetic а! less cynical.
| also feei less urges o watch pom and acy wart 1o go oxide, | ано ee that my emotion are les apathetic and less cynical.
Anonymous 1D:UclBLafo Wed 06 Oct 2021 01:14:24 No.342282030 ЗЕ Report
1 have to say, | enjoy how | feel after eating the horse paste. 10/10, would recommend
Anonymous 1D:1D4punEF Wed 06 Oct 2021 01:45:56 No.342285728 =5 Report Quoted By: >>342287174 >>342296510 >>342297874
I've been paraguard for a week 4x daily by 30 drops in a enteric capsule. | have not identified any critters in the stool. However effects are obvious.
1. Barely hungry. Zero carb cravings. 2. | feel lighter. | run better. Used to run cross country. Coaches commented on my ‘perfect form’ which went away. It's back. Never thought twice about this just figured out of practice.
The worms tried to psyop me and tell me I've had enough and that wormwood is dangerous. | persisted and during that nights sleep | woke up in what i'd describe as a psychotic type of state. Basically | was dying. But | logically knew | was not. But a voice in me kept insisting that it didn't matter what | thought ... it was a fucking terrifying thing. | prayed to Jesus to do battle for me and that stopped that right then and there. It was VERY alarming. I'd consider this schizoprhrenia type thought patterns. They weren't mine, since | am a stable genius unlike DJT who is a pretender.
That is with paraguard. | just got IVERMECTIN and | took a 17mg dose which apparently is all you should need to throttle them. I'll probably come back in a week or two with that.
ГІ Anonymous (ID: &GAZEFUGf») [1 10/06/21(Wed)01:47:16 No.342285878 >
22342279755 (ОР! | don't care what you suspect. | was misdiagnosed with IBS for 3 years. Parasite meds cured it for 27 dollars. | was paying
350 per month for my ibs meds
C Anonymous (10: GEINS
>>342290082
been looking for a good dewormer. this one looks good, im gonna give it a go. | water fasted for 10 days and when i finally pooped i had big white worms in my poop it was super gross. My doctor gave me a "trial run" of a antibacterial that also worked as an antiparasytic and it cleared all my symptoms up completely, i told him and asked for a proper protocol with the drug so it would kill everything and symptoms wouldnt come back but he didnt want to prescribe anymore.
10/06/21(Wed)03:19:08 No.342295083 |» >>342298218
C Anonymous (ID: G3 3) шш 10/06/21(Wed)03:33:02 No.342296481 »
>>342283699 No pictures but | just woke up and shat out two.
162
Same Google iqdb SauceNAO Trace FAVBwOcWQAUcgq-fjpg, 292КІВ, 1536x2048 Anonymous (ID: 6 ЕУ Э) = 10/06/21(Wed)03:57:40 No.342299021 » >>342299191 Anonymous 10:782721%А Sun 03 Oct 2021 20:53:51 No.341969790 ЗЕ Report Quoted By: »»341970116 >>341970372 >>341970547 >>341974298 Just checked my stool an hour ago after taking wormwood and fasting all day. Do it yourself and tell us
Guyana real what you find or shut the fuck up. My mind is blown.
This thing left my asshole and theres still a lot more to go i sometimes feel like theres something moving inside my ass 0 Anonymous (ID: €EED) = 10/06/21(Wed)03:59:30 No.342299191 » my orders are still coming 0_0 omg the jew worm is real. >>342299021 | shitted out worms today and my allergies are gone and sugar cravings are too. iqdb SauceNAO Trace & F8C5D5B8-5DF2-41C1-899B-3E41FF468 (...).jpg, 63KiB, 717x1024 аута mm [Report C Anonymous (ID: (ETD) = 10/06/21 (Wed)05:18:17 No.342306638 > >>341958167 >>342304857 D My mothers lyme's disease symptoms were cured the same fucking day she dosed horse paste. (((Тһеу))) are gonna | just did it, after taking wormwood and fasting all day. Its all fucking true. See for yourself. Also no urge ban that shit, watch. i to masturbate today, incredible.
IRI Piet ev REIS rav vn PND e sor FUCK MOEN нт Anonymous 1D:V4TGFHjm Tue 05 Oct 2021 03:33:57 No.342159110 Report
—— 22342158952 е! something rubbing on my ass n. Ivermectin horse paste worked for me. | no longer crave degenerate porn anymore. Not memeing.
land up Anonymous (ID: Ф009) = 10/05/21(Tue)13:32:42 No.3422d
fucking tape worm =a IFUCKING TAPE WORM ai Anonymous 1D:3rsAjc3f Sat 02 Oct 2021 23:29:53 No.341857894 ЕШ Rep
Ета IG IS AT LEAST 2 FEET LONG == 22341855713 22342202060 Ара ет A id i ucl BOWL Same here, since | did the wyrmpill treatment my craving for alcohol has been zero. While | dewormed myself and | no longer have allergies. WAS TRYING ТО GET BACK UP MY ASS. before | drank every day because | felt like shit in a shitty world.
The stuff that came out of my ass was freaky to see, but now | am convinced and wished | had
known earlier.
Anonymous Ір: ЕодзМујі Tue 05 Oct 2021 03:18:09 No.342157375 SS Report
SH IT WITH THE TOILET PLUNGER AT THE FLUSH HOLE ‘serus, тэе OMA DOWNY TOLET то ARE SURE та OT DONG TENE FOR MY азис І used to be gay, and then | took Ivermectin. You wouldn't believe how many worms and parasites came out of my butt... And after
UOH VHRLE WRANGLING THE TURD WORNI ee 5 ee that, | no longer felt the urge to have gay sex with men and transexual women. Now | am only attracted to real women.
JORM IS FINALLY FLUSHED USH ABOUT 20 MORE TIMES Ivermectin changed my life. 7
SO FLUSH BLEACH AND OTHER CHEMICALS DOWN МҮ TOILET TO MAKE SURE ITS NOT LURKING THERE FOR MY ASSHOLE USH ALL THE CHEMICHALS SO IT DIES * 9hHnS7Xkh e Е кел А ооа теза Anonymous 10: 9hiins7kh Mon 04 Oct 2021 23:46:45 [241 / 56 / 135] No.342132841 Sf View Reply Original Report IAT IN THE ABSOLUTE FUCK =S Quoted By: >>342133290 >>342133746 >>342134336 >>342134605 - — г "TID 22342135281 » 5342135322 >>342135784 » 5342135833 >>342135963 Anonymous (ID: (KKOriEpb) [ll 10/05/21(Тие)15:39:01 No.342216070 > 22342216473 rel 4 342136192 >>342136449 >>342136755 >>342137205 >>342138277 3 >>342141307 >>342141344 >>342141979 >>342143496 >>342143583 22342212642 >>342145074 >>342145250 >>342145397 >>342149312 >>342152221
>>. оар anon, | am on day 7 of the pine gum spirits cleanse and my psoriasis has diminished b: Kiop E E igre M eee y d y [poet Ne ур: y TOOB, zone 7s) >>342154936 >>342155064 >>342155816 >>342156457 >>342157094
over 50%. Nothing | have tried has ever worked like this. | have more energy, mental clarity, less head aches CHMX6RITRZHGDOVZCYLAMJSMBE jpg pep ‘view Same] [Google] 1595] [SauceNAO] [Trace 22342160160 >>342160664 >>342161350 >>342161631 >>342162067 тт >>342163222 >>342163722 >>342164710 You actually think something that comes from pine tree sap is suddenly bad for you, especially when people Have you taken the dewormer pill yet? have been using it since the time of Hippocrates? The only reason you take issue with pine gum spirits is >All mammals need dewormer at the vet because it is called "turpentine" so you think it is some how harsh. The medicinal effect is in the dose, >"N-no, not you got, don't you dare take it!” " еге >Brain fog gone | Anonymous (10: штіһдв/7 ) == 10/05/21(Тие)17:53:21 No.342230776 9 >>342230997 >Test way up 4 1jpg (631 KB, 960x782) >See worms come out as result гаа >Realize you were being poisoned Бу (((them))) this whole time using parasites and now know the cure.
и М >>342230698 When did you take the worm pill (gel) and realized we uncovered the secret to our own liberation?
0 Anonymous (ID: CEED) H2 10/06/21 (Wed)20:28:52 No.342381702 І» >>342382084 File: unnamed1 jpg (822 KB, 3024x4032)
>>342378013 | took pyrantel this morning and shat out some worms already. I've taken some Castor
|| Anonymous (ID: ) = 10/05/21(Tue)18:35:30 No.342235461 » Oil to try and get the rest out. I'm also fasting. е: B6B7B973-0626-42FB-822E-4(...).jpg (30 KB, 637x358)
22342235071
>| don't like to fuck with my body, it works fine
Dude | don't get sick either, | literally had no side effects aside from bad skin and
some lethargy, guess what? | took the wormwood and have been shitting out 2 = T
threadworms for the last week. It's real, if you think you don't need to at least try it С Anonymous (10: GEED) Н 10/06/21 (Wed 22:00:59, No 342396206) b.
then you're fooling yourself 5 | took a dewormer this morning and shat out worms already.
My ass is itchy right now. It feels like the next group is ready to come out. I'm a bit scared of [] Anonymous (ID: €IR7is3) zz 10/05/21(Тие)18:33:12 No.342235198 » what | will find this time.
| had crazy anal fixation until | dewormed myself, now the thought of sticking my dick in a pooper is Anonymous (ID: (CINES) zia 10/07/21(Thu)14:00:27 Мо.342472562 І» >>342472850 fucking grossing me out. what in the fuck ???
Also why do you guys buy all kind of crystal lady suplements | went to the pharmacy and just told the lady | had worms and didn't know which so she gave me some meds that work against many kinds and Day 1 - Begin water fasting
took the top dose. Day 2 - Pyrantel and Castor Oil Day 3 - Turpentine and Castor Oil
[| Anonymous = 10/05/21(Tue)19:19:38 No.342240467 |» 22342240522 >>342240536 | already saw worms in my stool yesterday from the Pyrantel. | also had a VERY ITCHY BUTTHOLE that has now went away.
342240583 >>342240708 >>342240874 72342240988 72342241063
le: D58B00A8-27FE-40DC-8A4D-1(...).jpg (2.12 MB, 4032x3024) ь 7 Му wife went from fever and headache with bad sore throat to fine іп 6 hours
>>342228968 (OP) WHAT DID I FUCKING TELL YOU THIS LITERALLY ГІ Anonymous (10: Nkx9ZuG7 ) = 10/07/21(Thu)18:06:40 No.342495579 >
I'm on day З of my detox
Anonymous (ID: “аумв/Нах ) == 10/07/21(Thu)17:55:24 No.342494331 P> >>342494412 >>342494609 >>342495005
inonymous 1D:4nRrPkDa Tue 28 Sep 2021 16:45:02 No.341254452 ШІ Report C Anonymous (ID: Gd») == 10/07/21(Thu)18:45:42 No.342499662 >
Duoted By: >>341254585 >>341254733 >>341256151 >>341256765 >>341260540 >>341261444 >>34127 1224 Why does deworming cure homosexuality? >>341253329 Why do | по longer get erections from watching дау рогп?? They release toxins into the stomach and brain. Used to be a fag until | detoxxed myself. Getting rid of parasites and worms isn't a meme. | broke up after detoxing myself after having a relationship for 3 years. Feels disgusting to think back about what I did.
163
L Anonymous (10: (6222 4 ( 9:43:08 File: Screenshot 2021-10-05 1.4(...).png (194 KB, 392x484)
ші 22342219942 (ОР)
Tve been experiencing some mild herxheimer reactions (as the parasites die, they release toxic crap into your blood; similar stuff happens with other T chronic diseases). I've been taking diatomaceous earth, tansy tincture, iodine,
as well as some pills | bought on Etsy (picrel) that are a combination of black walnut hulls, cloves, and wormwood. I've been working on the deworming process about a week. | have been getting headaches for a couple hours starting from 30 minutes after each dose. I'm unironically thinking "that means
it's working." Admittedly my diet was shit before and it's not much better now (gotta mix the
worm pills with the sugary stuff they like, right?) but I'm hoping the herxheimer shit ends soon.
1 have seen some small worms in my poopoo, so that has encouraged me to continue.
C Anonymous = 10/05/21(Tue)19:21:31 No.342240679 » >>342240765 »»342240826 22342240864. File: A371DC54-A66E-4211-B76E-C(...).jpg (1.61 MB, 4032x3024)
| - 22342240522 Better contrast
I'm currently on day 3 of my detox:
Day 1 - Fasting Day 2 - Pyrantel and Castor Oil Day 3 - Turpentine and Castor Oil
| already saw worms in my stool yesterday and had a really itchy butthole, which went away after | fully emptied my bowels. It seems it's working. | took the Turpentine around noon but | don't really feel anything other than a bit of nausea. | took 2 sugar cubes with about 1/2 teaspoon on each. Just took the Castor Oil an hour ago so that should kick in soon.
The plan for tomorrow:
Day 4 (morning) - Turpentine and Castor Oil Day 4 (evening) - Break my fast and have a nice dinner
Then | will recover, eat healthy, and monitor results. | will do a follow-up detox in 2 weeks time.
C Anonymous (ІП: 448ЖІККӨ)) == 10/07/21(Thu)19:59:07 No.342507458 |» >>342507653
| | Anonymous (10: #19169) i Е 10/05/21(Tue)20:23:49 No.342247936 » >>342249251 ile: kike.jpg (1.61 MB, 4032x1960)
1 was symptomless save for farting too much. | did a 3 day mebendazole/ivermectin run and | shat out some parasites.
| fart a lot less, and have also stopped craving or drinking alcohol.
| didn't take pics but it resembled pic related. There were small ones too.
| Anonymous (ID: ‘GagnV5tw)) == 10/07/21(Thu)19:52:16 No.342506669 |» >>342507054 b: IMG 20211007 144607857 sc(..).png (2.34 MB, 1875x2500)
22342485227 (OP) To all the naysayers saying "well noone is showing us pictures of their poop" well, here you D fuckin go. l've been on the black walnut/cloves/wormwood for a week now and had the serious urge to shit.. crapped this little fucker out. Try and tell me that's mucus or something other than a threadworm. | shat out my first ones about two days in and on the third and fourth day | had a SERIOUS sugar craving and satiated it. Basically gave them some energy for the new generations just hatching. I'm on a full sugar fast and eating strictly fats, proteins and non starchy veg. | feel perceptibly different and | feel good being responsible for my health BUT it is very reminiscent of a nofap streak where the cravings are super intense and almost overrode my own thinking "NO". This shit is very real and | hope you all take it seriously, I'm a healthy male in my late twenties
Please somebody help me tell me how to reverse this i just want to enjoy my gay porn and i cant because It doesnt turn me on anymore please how do i reverse this
| thought all this talk about deworming and homosexuality was bogus i just want to get off to gay porn please somebody help me reverse this i dont know what to do
C Anonymous (ID: 4665202) 213 10/07/21(Thu)19:56:32 No.342507157 № >>342507323
22342506669
| take a spoon of sugar laced with turpentine. The idea is the parasites go for the sugar and end up consuming the turpentine and die off. | feel better because of doing turpentine
C Anonymous (10: auf) == 10/08/21(Fri)17:48:35 No.342622271 » File: IMG 20211008 081214 01 _01,jpg (544 КВ, 1132x1515)
4 >if this works why doesn't anyone post pictures of worms in their shit Here you go, this is from this morning. Day 9 on wormwood/black walnut/clove remedy. Tell me these aren't fucking worms. It's even more obvious in person.
C Anonymous (ID: MEB) 1: 10/08/21 (Fri)00:38:21 Мо.342538645 |» >>342539075 >>342539151 >>342539218
with indescribable issues with motivation and focus for a loooong time. Feeling relief from it all and feeling File: unnamed1 jpg (822 KB, 3024x4032)
liberated. Godspeed anons and be safe with it, my treatment is not long term and you also need to take Arginine and Ornithine to help your body combat the massive dump of ammonia when these little fuckers get blasted
Anonymous (ID: = 10/08/21 (Fri)21:33:04 No.342646361 »
>>342626641 (OP) Im on day 3 of walnut/wormwood/clove caps. Had a bunch of tiny white stringy things floating in toilet water after pooping. Guess you guys were right, again.
Pol is always right.
|) Anonymous (ID: 6 ШЕЗШИӘ)) 21: 10/08/21 (Fri)12:59:05 No.342598536 >
>>342597038
You can get 90 wormwood pills for £7, | got the cheap plain ones (without black wallnut). Genuinly did not expect anything and it to be another retarded /pol/ larp. but here | am 24h later shitting out worms like a diseased lepper.
Also took 1/2tsp ground cloves mixed with water from the spice rack also as that suposedly helps kill the eggs, read that its best to fresly grind whole cloves, but | only have the powdered stuff.
|] Anonymous (ID: «EIE SIS 10/08/21(Fri)00:31:02 No.342537880 |» >>342538103 >>342538144 >>342538261 le: unnamed. jpg (1.19 MB, 3024x4032)
>>342536146
>>342538144 Yeah | got a pic of this guy when | wiped my ass. There were several bigger ones in my stool but | didn't fish them out. There were also lots of white balls which looked like eggs.
>>342538103 That is the human one. It worked really well and is strong.
okay so i have been taking ivermectin for 3 days now and last night i felt this rush and energy after i took a shit that smelt like there were dead worms in it, i couldn't sleep right away and woke up early did this happen to anyone else?
ГІ Anonymous (ID: vxdax4y@y) == 10/07/21 (Thu)23:47:33 No.342533211 >
22342531717
>within the fist week
Maybe not. | just started seeing them today on day 8 using the typical wormwood/walnut/clove remedy. | started with pills but | also ordered a tincture that contains a few extra things and so | started taking some of that on top of the pills yesterday and today | started actually seeing worms. I'm thinking maybe the tinctures do work better, but also I'm 230lbs so it also occurred to me that might just need a larger dose. It's not like these bottles say anything about dosing based on weight after all.
| drake a whole bottle of Reeses yesterday whcih is 1500mg Pyrantel. | shat out some C Anonymous (10: 4Мхбахауа)) M] 10/07/21(Thu)21:12:26 Мо.342515788 & worms and feel great now. File: 1633456842578.png (1.4 MB, 1600x983)
Anonymous (ID: «а 10/07/21(Thu)21:14:06 No.342515977 »
22342515654 the only thing that helps me with stress is medication and long walks in nature. As well as the parasite pill. Psoriasis is way down, energy and restfulness way up.
[| Anonymous (ID: Фа ЖЭЭ) == 10/07/21(Thu)18:37:31 No.342498786 > le: 1633581832177 мет (2.86 MB, 640x352)
I've taken (4) doses of ivermectin (horse paste) spaced out over a span of 8 days.
I no longer have an erection when viewing homosexual pornography.
My energy levels have improved and i feel like i can actually get up in the morning
I have less body aches, and my mood is improved
I think i am going to try the wormwood/black walnut/clove combo to finish it off, after i finish the rest of the ivermectin
Boon a lotta Racists online
tryna spread FAKE NEWS
164
22342514904 Yeah, many such cases. Here's a few relevant links if interested.
Parasites cause cancer: https://files.catbox.moe/wupj3t.pdf
Things that kill parasites can also cure cancer: https://youtu.be/HYILnjc wuY [Embed]
Man cures cancer with B17: https://www.youtube.com/watch?v=hmkkwBTqVPc [Embed] (((ҒОА))) shuts it down:
https://www. youtube.com/watch?v=gBQD9IRr6Ow [Embed]
| shit out my first clearly identifiable worms today on day 8 with wormwood/walnut/clove. Three little white stringy fuckers maybe half а millimeter wide and about 1-2cm long. Was starting to think | wouldn't see any, but | really don't feel like straining and sifting through my shit. Going to take a break after this, do a short 3-5 fast, then start on turpentine after. Then | might a round of ivermectin and a round of fenbendazole after that (just because both are easy to obtain), followed by taking small amounts of turpentine regularly for maintenance. One way or another I'm going to kill these little fuckers. Hopefully it helps with some mysterious health issues that started up for me in recent years.
12. TREATMENTS ANTIHELMINTHICS............. ————————— iei ———ÀXP ТЕРЕ .166
HERBAL TINCTURES...............-« op RR cs sccosecasesvusersecsusecssrscsesseesearseeseeneer 167 TURPENTINE............. АНИНЕ... ee 168 ZEOLITE CLINOPTILOLITE........................-- E TNA: қ.%...............169 INL COT NMR И. ЕЕККИКЕКЕКТЕНЕ mA A b... 170 СІЛТІ ҰЛА ЕНЕИКИИИИККИКЕКИКНЕКЕКЕКЕКИКЕКККЕНЕ к. ятһа А171 РВОВІӨТІСС...... ee nn An 8 172 ALCOHOL............. c жа —À ^ NE HW AM NEN 1.8172 FASTING............. cernentes Ed БИН яғ ^ M of M2174 TUA eoa. E a a A ne ae 174 FREEZING............... ener M және OST — /.А......174 MEDICINAL РІАМТ5.............. Шаа _ /.А...........!175 LIVER FLUKE TREATMENTS..0...scssssssssssssessesssssesssssssessssssssssssscsssessesssssessessseessessssesseseeL 75 МІТА2ОХАМІРЕ........................ Ma wu НЕ eee 176 BIOFILM TREATMENT S............... eren —— ЕТЕКТЕН КЕНЕ г).
SILVER. ЛЕТИЕ ЕРЕКЕ ЕКЕ CO E UE ERES IS
Treatments pdf: LINK
Herxheimer Reactions
As parasites die, they release toxins through their excrement and from rotting. The most common parasites, the worm type, attempt to escape by burrowing deeper into the intestines, which can cause sharp cramps. Even when dead, the body is still burdened with the task of flushing them out. This whole process can make the person feel sicker than he was before he began the cleanse, but this is only temporary, and it is a sign that the cleanse is working. It is known as a Herxheimer reaction when people become sicker as a result of the toxins that are released by dying parasites. While fatigue and grogginess are to be expected, normal life may be continued, and diarrhea should not occur. Eat a good, wholesome diet throughout the cleanse to ensure that your immune system is at its strongest. After the cleanse, you should feel better, have more energy, and experience sickness less often.
165
сазы
IVERMECTIN етет) PASTE 1.87%
Anthelmintic & Boticide Apple Fla vored! Removes worms and bots with a single dose. a
Net WE. 0.21 oz (6.08 g) Cortes wi feat ср io 1250 b bocy er ANADAR 200.928, Aged ty FOR
Abstract and Figures
Objective: Ivermectin and sulphadiazine were tested individually to determine their in vitro effects on Toxoplasma gondii grown in human epidermoid larynx carcinoma (Hep-2) cell culture. Study Design: In-vitro study. Material and Methods: Toxoplasma growth was quantities by an enzyme immunoassay performed directly on the fixed cultures, using a rabbit anti-T. gondii immunoglobulin G as the first antibody and a phosphatase-labeled anti- rabbit immunoglobulin G as the second antibody. For each drug, regression models were used to quantify the relationship between optical density values and antimicrobial agent concentrations in the cultures. Results: The 50% inhibitory concentrations (1С50) of ivermectin and sulphadiazine were found to be 0.2 ug/mL and 7.3 pg/mL after 48 h of exposure, respectively. None of the concentrations tested for each drugs demonstrated toxicity to Hep-2 cells after 72 h of incubation. Conclusion: These results indicate that ivermectin significantly inhibited replication of the tachyzoites of T. gondii RH strain
Anonymous (ID: SmooOXqv4 ) [ll 10/30/21(Sat)18:35:52 No.345439600 |» >>345440176 >>345440246
22345438799 »ivermectin supposedly only works on the immature worms
Hey mexibro you have this wrong. Ivermectin works on adult worms, by interfering with their gaba receptors. For you, add some abendazole (Vernox plus) to your anti parasitic regimen. Readily available in Mexico.
The antiviral property is something else, it is also an "n1 nuclear inhibitor" it prevents viruses from infecting the nucleus of your tcells. It's when they're infected , that they can't undergo mitosis and reproduce. That's how people with aids lose their tcells / immunity and die.
So the anti parasitic and antiviral property of ivermectin work differently. Ivermectin has no effect on eggs and nymphs. That's why you dose at like days 1,2,8,апа 30 and then regularly for a 2 day cycle at 6 months. More aggressive for covid prophylaxis or if you have a permanent viral infection you're using it off label for like herpes or hiv.
Im hiv* and ditched my 3000/medicine for 6mg of ivermectin a day and I'm remaining undetectable for 3+ months
Ivermectin does not pass through the blood-brain barrier and so has no effect on parasites which have entered the brain. Even though it is the most effective anti-helminth on the market, it has no effect on fungal parasites. If you believe you are infected with a fungus, consider fenbendazole, which treats both helminths and fungus. If you gain temporary relief from fenbendazole or ivermectin, but your symptoms keep recurring, it is possible your central nervous system has been infected. Mebendazole will bypass the blood-brain barrier to treat such infections.
| |— . . Antihelminthic Therapeutic Agents and Indications for Their Use Drug Effect Used for Albendazole Blocks key step in worm metabolism Filariasis, ascariasis, strongyloidiasis, and some adult worms Diethylcarbamazine Unknown but kills microfilariae Filariasis, loiasis Ivermectin Blocks nerve transmission Onchocerciasis, ascariasis, strongyloidiasis Mebendazole Blocks key step in worm metabolism Trichuriasis (whipworm), ascariasis, hookworm, trichinosis
Metrifonate Paralyzes worm Schistosomiasis
Niridazole Alters worm metabolism Schistosomiasis Piperazine Paralyzes worm so it can be expelled in feces Ascariasis, pinworm, hookworm Praziquantel Interferes with worm metabolism Schistosomiasis, other flukes, tapeworm
Pyrantel Paralyzes worm so it can be expelled in feces Pinworm, hookworm, trichinosis
Thiabendazole Blocks key step in worm metabolism Strongyloidiasis, guinea worm, hookworm trichinosis
166
HERBAL TINCTURES
These three herbs must be used together. Black walnut hull and wormwood kill adults and developmental stages of at least 100 parasites. Cloves kill the eggs. Only if you use them together will you rid yourself of parasites. If you kill only the adults, the tiny stages and eggs will soon grow into new adults. If you kill only the eggs, the million stages already loose in your body will soon grow
into adults and make more eggs. They must be used together as a single treatment.
Anise Honey Ashwaganda M. Pudica Astragalus Mirnosa Public Barbary Root Mullein Berberine Moringa (moringa oleifera) Black Walnut Neem | с, Cayenne Pepper Nettle Black Walnut Capsaicin Olive Leaf Wormwood Carrots Oregano Oil Complex Cascara Oregon Grape Herbal Supplement Clove Oil Papaya Seeds Rowe TI OZ. (59 rM Coconut Oil (for candida) Pau D’Arco ші іш, Curaco Propolis Curled Mint Pumpkin Seeds
ParaGuard” Epazote Raspberry Leaf Fennel Seed Sage Garlic Tansy Ginger Thyme Goldthread Triphala Goldenseal Turmeric Grapefruit Seed Extract Vidanga Holy Basil Wormwood
Conclusion: These results show that although M. pudica has weak anthelmintic effects compared to albendazole (standard anthelmintic), in vivo and in vitro, at the doses used in this study, nonetheless, it reduces worm burden and improves haematologic parameters, serum total protein, albumin and overall weight gain of the treated mice. Thus, increased doses may be effective in anthelmintic chemotherapy.
@ academic.oup.com/femsle/article/367/23/fnaa194/6000212 Effect of capsaicin on the protozoan parasite Trypanosoma cruzi <>
Edward A Valera-Vera, Chantal Reigada, Melisa Sayé, Fabio A Digirolamo, Facundo Galceran, Mariana R Miranda, Claudio A Pereira &
FEMS Microbiology Letters, Volume 367, Issue 23, December 2020, fnaa194, https://doi.org/10.1093/femsle/fnaal94 Published: 24 November 2020 Article history v
PDF MsSplitview 66 Cite # Permissions «$ Share v
ABSTRACT
Trypanosoma cruzi is the causative agent of Chagas disease. There are only two approved treatments, both of them unsuitable for the chronic phase, therefore the development of new drugs is a priority. Trypanosoma cruzi arginine kinase (TcAK) is a promising drug target since it is absent in humans and it is involved in cellular stress responses. In a previous study, possible TcAK inhibitors were identified through computer simulations resulting the best compounds capsaicin and cyanidin derivatives. Here, we evaluate the effect of capsaicin on TcAK activity and its trypanocidal effect. Although capsaicin produced a weak enzyme inhibition it had a strong trypanocidal effect on epimastigotes and trypomastigotes (ІС. = 6.26 рМ and 0.26 uM, respectively) being 20-fold more active on trypomastigotes than mammalian cells. Capsaicin was also active on the intracellular cycle reducing by half the burst of trypomastigotes at approximately 2 uM. Considering the difference between the concentrations at which parasite death and TcAK inhibition occur, other possible targets were predicted.
Capsaicin is a selective trypanocidal agent active in nanomolar concentrations, with an IC... 57-fold lower than benznidazole, the drug currently used for treating Chagas disease.
pubmed.ncbi.nlm.nih.gov/
Evaluation of the anthelmentic activity of garlic (Allium sativum) in mice naturally infected with Aspiculuris tetraptera
Erol Ayaz , Idris Türel, Abdurrahman Gül, Orhan Yilmaz
Affiliations + expand PMID: 18673129 DOI: 10.2174/157489108784746605
Abstract
This study was performed to investigate the anthelmentic (nematodes) effect of garlic in Swiss albino mice naturally infected with Aspiculuris tetraptera. Natural infection was determined by the use of cellophane tape method on the perianal region and by the technique of centrifugal flotation of stool samples. The infected mice were divided into three groups; namely, Group 1: garlic treatment groups (n: 18), Group 2: positive control (treated with ivermectin, n: 19) and Group 3: untreated control group (n: 19). The mice in Group 1 were given orally freshly crushed garlic homogenates every day for 7 days. The animals in Group 2 were treated with ivermectin intramuscular at a dose of 0.2 mg/kg body weight. The mice in Group 3 received only serum physiologic orally. After 8 days of administrations, all mice were killed humanely using inhalation anaesthesia and then the parasites in the intestine were counted. It was observed that tetraptera I naturally infected mice, respectively. Results obtained from this study were compared statistically and differences were found to be significant (p<0.001). It was found that garlic was efficient along the duration of the treatment in mice. Garlic may be useful as an alternative treatment against nematode parasites in animals and human. This article includes a new research using Allium sativum anthelmentic effect on mouse and has been patented.
167
TURPENTINE
Tree Resins [Pine Gum spirits] and Castor Oil Turpentine: LINK
It is important to use the turpentine which is labeled ‘Pine Gum Spirits’ and is made from distilled pine tree sap, and not the turpentine found in hardware stores which is a toxic solvent made from petroleum distillates and used as paint thinner.
E
N
[2]
|
—-|o N nje a a A w [^] [^] = = ok
=à | «а WIN a [^] =
= | os nje
= o e e =
№ |= | | о [Ф [Ф| ~ 21] w m
N pg
N N
N Co
Oh yeah, and #4
>Castor oil Castor oil taken orally with 1 cup of coffee and some honey. Castor oil is the most potent purgative on Earth and it fucking NUKES the parasites. Destroys their biofilm too so they slide off the colon wall. The honey further acts as a lure.
The castor oil needs to be cold pressed and bought from a legit source. Potency is key.
If you're loaded with fungus (99% of us are), you will feel like the black death itself after taking this substance. 22 tbsp of castor ой
71 tbsp of honey
>1 cup of coffee, light roast organic
Then you wait 5 hours and do a coffee enema ala Max Gerson-style, this is very important or you won't finish the expulsions and you'll still feel incredibly ill. To finish >1 liter of coffee, light roast organic
>2 tbsp of castor oil
>2 capsules of ox bile, removed from capsule and dumped into solution
>rub ORGANIC castile soap into solution for a few moments
This creates a suspension of liposomal castor oil which will purge every last fucking thing in your colon. Stir continuously as it enters you as the castor oil will rise to the top of your enema bucket. Try to hold for as long as possible then prepare for the greatest and unholiest bowel movement of your life.
I'm not kidding you anons when | say this nukes EVERYTHING. But it's selective, only the bad shit goes.
Do this every other day while fasting and | guarantee you, within two weeks you'll feel invincible. And you will be, compared to those around you.
168
ZEOLITE CLINOPTILOLITE
Zeolites are porous minerals with high absorbency and ion-exchange capacity and are an excellent detoxifying, antioxidant and anti- inflammatory agent.
Could Antiparasitic Cure with Clinoptilolite be Achieved in Dogs Naturally Infected with Giardia Duodenalis?
Adnan AYAN*!, Songül ERDOGAN?
"Van Yusuncu Yil University, Faculty of Veterinary Medicine, Department of Genetics, 65080, Van, Turkey 2Adnan Menderes University, Faculty of Veterinary Medicine, Department of Internal Medicine, Aydin, Turkey
ABSTRACT The aim of this study was to determine the antiparasitic efficacy of the natural zeolite component, clinoptilolite, against naturally occurring giardiasis in dogs. Seven infected dogs, aged 6-44 months of age, both sexually owned and diarrhea infected with Giardia duodenalis in the Aydin region were used in the study. Group I was administered clinoptilolite orally for 10 days at a dose of 2 g / kg. Group II dogs were provide to stay in the control group. The antiparasitic efficacy of clinoptilolite in dogs was evaluated by microscopic examination of stool samples collected at the beginning 0, 3rd, 7th and 10th day by rectal route. Considering the reduction in cyst excretion per gram feces, clinoptilolite used for anti-giardial purposes provided 99% efficacy in cyst excretion at 10th day. In the treatment group, the mean geometric averages of cyst counts were determined as 200552.4, 37.8, 113.3, 10.4, respectively, on days 0, 3,7 and 10. On the other hand, in the control group, no significant change was observed in the geometric mean of cyst ruble excretion on day 0 (195099,4) 10 days (174436,1). It can be said that clinoptilolite effectively decreases cyst excretion in dogs with giardiasis and can be used in the recommended dose
wi i 7 si ffects. without causing any side effect [) Protocol master 03/12/22(Sat)12:42:17 No.31249675 |.2>>31249889 >>31251310
le: 20404.jpg (2.04 MB, 2677x3189)
The best method for removing them is as follows.
>Zeolite, Clinoptilolite, 90%+ purity, activated, in powder form »Coffee, light roast, non-ETO, organic
You take two tablespoons of zeolite (with a plastic'wooden spoon) four times а day, mix it with RO/distilled water.
You take four coffee enemas a day. You boil 1 quart of water, add three tablespoons of coffee, boil it for 5 mins, simmer for 15, wait for it to cool to body temperature or add no more than 1 extra quart of water to cool it.
Putit in a stainless steel enema bucket with a non-plastic tube (silicone pref), lay on your right side and hold it for 15 minutes.
If this is your first time, you will not be able to hold it. Instead, take 3 quarts of warm water and expel until your expulsions are mostly clean. Then re-attempt the coffee enema.
|) Protocol master 03/12/22(Sat)12:55:59 No.31249766 | 2>>31249889 le: zeolite.png (136 KB, 850x363)
HEILTR()PFEN r ВЯ В . mam u i Zeolite Clinoptilolite li лашка Спіс d powder The zeolite is an aluminosilicate mineral with a rigid anionic framework containing well-defined
3xTMA micronized. Particle sizes range from 0.32 to 1.36 pm. Glinoptilol (Tribo-mechanical activated)
Net. Wt.: 0.551Ь (250g) С
channels and cavities. It has negatively charged ions that bind to positively charged molecules. It has a honeycomb structure which encases positively charged molecules, of which most are harmful in nature.
In layman's terms, it is able to bind to -- trap - and eliminate toxins, parasites, and heavy metals. This has been studied extensively. It is also used at nuclear disaster sites to absorb radiation.
It is the most powerful detoxifying substance known to man, apart from maybe glutathione and R-lipoic acid. It is certainly the most functional method for detoxification in that it traps and removes all three major causes of disease.
It does not kill parasites. It embalms them, then buries them alive. It traps toxins. And it traps heavy metals. By it's natural attraction to heavy metals, all parasites are removed in the process.
The coffee enema dilates the bile ducts. The caffeine in the coffee irritates the liver, which is stimulated to release it's accumulated toxins. The liver is the foremost detoxifying organ in the body. The coffee directly aids this process, allowing you to detoxify when fasting far quicker. Around 3x faster in my experience. What may take hours for your liver to process is instead dumped back into the colon where it is quickly excreted with the coffee.
Bile production is also stimulated, and gallstones are released. The bile also compounds with the zeolite to effectively annihilate the parasites.
This protocol is cheap, extremely effective, and scientifically sound. You do not need to buy expensive herbs or supplements. Just two items are required. Water fasting is obligatory in this process. You can expect to see expulsions begin en masse within two days.
Parasites are attracted to heavy metals. Especially mercury. Remove it from your body and the parasites will go to. I've expelled dozens of parasites using these herbs, but my gut was still huge and | was still unhappy. | had to spend thousands of dollars on it all.
Then you take zeolite and coffee enemas. Boom. Thousands upon thousands of worms, flukes, candida and the like comes out in a tidal wave. It smells like a demon. It is the worst smell you can possibly imagine. A metallic smell, rotting flesh, and sulfur is the best description. Even smelling it is enough to make you feel ill.
That's why you should only take those two substances too, because there can be no doubt in your mind that it is real.
169
NICOTINE
Nicotine kills parasites and bypasses the blood-brain barrier, making it one of the most effective methods for removing brain parasites. By killing brain parasites, it removes the inflammation in the brain, eliminating brain fog and causing it to be considered a nootropic. It also balances out hormones (raising testosterone) by removing the parasites which are disrupting hormone production when they infect
the many glands found in the brain. Nicotine, by itself, is non- in ^ addiction forming when used in low doses; however, most people Nicotine get nicotine from tobacco cigarettes, which almost always use harsh Lozenges chemicals during processing. These chemicals act as food for para- Nicotine ae sites and can lead to cancer in the lungs (if smoking the tobacco) or Stop Smoking Aid
in the throat (if chewing). It is these chemicals which causes ciga- THEIR FIRST CIGARETTE WITHIN
rettes to be addictive due to the parasites using the chemicals as a you smoka yar A sm food-source. For all of these reasons, smoking and chewing tobacco eim m should be avoided unless one grows and processes his own tobacco. The one exception to this is Snus, which does not seem to contain the chemicals. Even if the chemicals are somehow avoided, the ash from smoking can also cause significant lung problems, and so one should limit one's tobacco smoking by using pipes (not cigarettes) in well ventilated areas (to avoid second-hand smoke from the pipe).
CANNABIS
Cannabis reduces inflammation which causes pain by killing the worms that cause inflammation, but there are several studies linking extended cannabis use to brain damage. As a result, cannabis ought to be avoided as an anti-parasite treatment. LINK1 LINK2
SULFUR
veterinary medicine, and also against domestic pests.
Nowadays it is still used in agriculture (e.g. in wine and fruit growing), often in integrated programs together with other organic pesticides. Usage against veterinary parasites is irrelevant.
So far there are no reports on parasite resistance to sulfur, which is not surprising considering its very scarce veterinary use.
DMSO, Antabuse, and Methylsulfonylmethane (aka: MSM or DMSO2) are all derivatives of Sulfur. They function in ways similar to sulfur but are generally considered safer to consume.
ANTABUSE AND ETHYLALCOHOL
B. Toxicity.
Microorganisms are comparatively sensitive to Antabuse. A 0.1% emulsion in water containing 10% alcohol is bacteriostatic for staph. aureus at dilutions of 1:8000—1:16000, giving a final concentration of not more than 1:8 х 10* — 1:16 x 108. Even worms are sensitive to this substance. In vitro trichuris leparis is killed after 1 hour at 37° with 100 mg % tetraethylthiuram- disulphide in Ringer’s solution containing 2% alcohol. An in- take of 0.25 g Antabuse daily for 4—6 days is able to free rab- bits completely from parasite eggs in the faeces. Tetraethyl- thiuramdisulphide has, moreover, been used as a scabieticide with some effect (HAMMARSKJÖLD, 1943; Boas and LAUSTEN HANSEN, 1945).
The high toxicity in lower animals is presumably due to the capacity of Antabuse to form complex compounds with copper. Copper enzymes essential to the metabolism of these animals are thereby blocked.
The compound possesses a, very low grade of toxicity for mam- mals. In puppies and rabbits the fatal oral dose was found to be
171
PROBIOTICS
1
В Bucková *, Z Hurniková 1, A Lauková 2, V Revajová 2, E Dvorožňáková !
Affiliations + expand PMID: 31662635 PMCID: PMC6799552 DOI: 10.2478/helm-2018-0010 Free PMC article
Abstract
ҰС: Ергоіесінуе effect of probiotic strains against zoonotic Trichinella әрігай infection was investigated in the framework of a new therapeutic strategy aimed at using probiotics to control parasitic zoonoses. The study was focused on the impact of six selected probiotic (bacteriocinogenic) strains on the intensity of T. spiralis infection and female fecundity ex vivo and in vitro. Bacterial strains of different origin (Enterococcus faecium EF55, Enterococcus faecium 2019 = CCM7420, Enterococcus faecium AL41 = ССМ8558, Enterococcus durans ED26E/7, Lactobacillus fermentum AD1 = ССМ7421, Lactobacillus plantarum 171/1) were administered daily іп a dose of 109 CFU/ml іп 100 pl, and mice were infected with 400 T. spiralis larvae on day 7 of treatment. Female adults of T. spiralis were isolated on day 5 post infection (p.i.) and subsequently were used in fecundity test ex vivo. Е. faecium ССМ8558, E. faecium ССМ7420 and E. durans ED26E/7 strains significantly reduced the number of adults in the intestine. The application of L. fermentum ССМ7421, L. plantarum 17L/1, E. faecium ССМ8558 and Е. durans ED26E/7 caused a significant decrease in the number of muscle larvae. The treatment with E. faecium ССМ8558 and E. durans ED26E/7 showed the highest inhibitory effect on female fecundity (94 $). The number of newborn larvae (NBL) was also significantly decreased after administration of L. fermentum CCM7421 and L. plantarum 17L/1 (80 ?5). A direct impact of probiotic strains on female reproductive capacity was examined in vitro in females isolated from untreated infected mice on day 5 p.i. A correlation was found between the inhibitory effect and the concentration of probiotic strains. The reduction effects of the strains manifested as follows: L. fermentum CCM7421 (93 $), E. faecium ССМ8558, L. plantarum 17L/1, E. faecium EF55 (about 80 $), E. faecium ССМ7420 and E. durans ED26E/7 (about 60 %).
| Anonymous (ID: (@at6GHVA) == 09/28/21(Tue)16:49:43 No.341299055 |» >>341299456 >>341299840 >>341300265 >>341304920
22341269537 so the entire cause of societal degradation is parasites. So in the Weimar republic when children were being prostituted that was due to parasites, then Hitler eventually came to power and as we all know dispensed ivermectin and everything was fixed. Not like there was any other cause of societies ills.
| Anonymous (ID: ҮШТІ) = 09/28/21(Tue)16:56:03 No.341299840 »
22341299055 Sauce on Hitler deworming process? Never seen that anywhere can't find it.
Anonymous (ID: 4OWMIFBAD) == 09/28/21(Tue)17:35:18 No.341304920 » >>341305191
27341299055 strangely enough, probiotics can help with parasite infestations, and we all know that sauerkraut is the #1 probiotic in the world. | assume that the krauts just dewormed themselves once the jews were prevented from continuing to spread parasites. hitler did stop the jews from mandating the jew vaxes.
Anonymous (ID: &GVIMIFBA) = 09/28/21(Tue)17:37:27 No.341305191 |» >>341310205 : 1627275866914 jpg (11 KB, 225x225)
77341304920 https-//pubmed.ncbi.nlm.nih.gov/31662635/
| mean, it all makes sense. the germans accidentally dewormed themselves by just getting rid of the jew vaccines. anons, we are on to something...
Anonymous (10: (СШ?) = 09/28/21(Тие)18:17:05 No.341310205 > >>341311691 >>341312511 : 1632866549232 jpg (99 KB, 1024x751)
27341305191 Making Sauerkraut right now. Little demons never stood a chance.
172
ALCOHOL
2 2012 — Alcoholic drinks aren't generally put into the category of health food, but in some cases they might be just the cure for nasty parasites.
The gut worms which lower testosterone and turn people into homosexuals can be killed with alcohol, par- ticularly with hard alcohol, but the alcohol also harms your blood-brain barrier, making you more likely to become chronically infected by brain parasites that cause depression, addiction, and neurological problems. This is why alcoholics tend not to be pussies or faggots, but they do tend to get depressed a lot and suffer from many kinds of addictions. It is best to avoid alcohol altogether in lieu of other treatment options.
799986/
pubmed.ncbi.nim.nih.gov/33
Alcohol-Induced Blood-Brain Barrier Impairment: An In Vitro Study
Donatello Carrino 1, Jacopo Junio Valerio Branca *, Matteo Becatti 2, Ferdinando Paternostro 1 Gabriele Morucci 3, Massimo Gulisano 1, Lorenzo Di Cesare Mannelli 4, Alessandra Pacini 1
Affiliations + expand PMID: 33799986 PMCID: PMC7967408 DOI: 10.3390/ijerph18052683 Free PMC article
Abstract
In recent years, alcohol abuse has dramatically grown with deleterious consequence for people's health and, in turn, for health care costs. It has been demonstrated, in humans and animals, that alcohol intoxication induces neuroinflammation and neurodegeneration thus leading to brain impairments. Furthermore, it has been shown that (BBB), but the molecular mechanisms underlining this detrimental effect have not been fully elucidated. For this reason, in this study we investigated the effects of alcohol exposure on a rat brain endothelial (RBE4) cell line, as an in vitro-validated model of brain microvascular endothelial cells. To assess whether alcohol caused a concentration-related response, the cells were treated at different times with increasing concentrations (10-1713 mM) of ethyl alcohol (EtOH). Microscopic and molecular techniques, such as cell viability assay, immunofluorescence and Western blotting, were used to examine the mechanisms involved in alcohol-induced brain endothelial cell alterations including tight junction distribution, apoptosis, and reactive oxygen species production. Our findings Clearly demonstrate that alcohol causes the formation of gaps between cells by tight junction disassembly, triggered by the endoplasmic reticulum and oxidative stress, highlighted by GRP78 chaperone upregulation and increase in reactive oxygen species production, respectively. The results
173
FASTING
Fast for 72 hours and not a minute less. This kills off your white blood cells forcing them to regenerate after the fast. In nature animals naturally fast for periods, so it is built into your biology to expect it. When you never fast, you are operating your body in an unnatural state and your white blood cells never get a chance to reset as they should.
Less than 72 hours isn't enough. Much more doesn't seem to be necessary. LINK
BAKING SODA
Baking soda is also an effective natural remedy for parasitic worms which can infest the digestive tract. Before bed, dissolve a quarter teaspoon of soda in warm water and drink. Repeat every night for three days
America’s 4 to remove parasites from the body.
#1 Trusted Baking Soda Brand
GE |
Baking 504)
icarbonat | de 54
FREEZING
by y irradiation (Dubey et al. 1986). These data are now used by regulatory agencies to advise consumers about the safety of meat. Freezing of meat overnight in a household freezer before human or animal consumption remains the easiest and most economical method of reducing transmission of T. gondii through meat.
MEDICINAL PLANTS
https://www.sciencedirect.com/science/article/ pii/S1995764516301298
medicinal plant extracts-A mini-review Ibrahim Al Nasr 1» ? 9 14, Faiyaz Ahmed 2, Fawaz Pullishery ?, Saeed El-Ashram % 5, Vardharajula Venkata Ramaiah 2
able 1 ledicinal plants used for the treatment of various parasitic infections, including 7. gondii. Parts used
Stem and leaves Stem and leaves Stem and leaves
Extraction method
Air-dried, powdered and ethanolic extract Air-dried, powdered and ethanolic extract Air-dricd, powdered and cthanolic extract
Plant name
Vernonia colorata Zingiber officinale Sophora flavescens
Stem and leaves Roots
Torilis japonica Eurycoma longifolia Calotropis procera
Air-dried, powdered and ethanolic extract Air-dried, powdered and methanolic extract Air-dried, grounded and ethanolic soak
Pulicaria crispa Air-dried powdered and methanolic extract
Euphorbia retusa Dried at room temperature, powdered and methanolic extract Air-dried methanolic extract
Air-dried chloroformic extract
Rumex spinosa
Leaves and flower Air-dried powdered and methanolic extract
Lycium shawii Leaves Oven-dried, grounded and methanolic extract
Stem and leaf Air-dried ethanolic extract (olco-gum resin) Stem and leaf Stem and leaf
Commiphora Molmol (Myrrh) Curcuma longa Juniperus procera
Air-dried, water and ethanolic extracts Air-dried ethanolic extract
LIVER FLUKE TREATMENTS
Praziquantel
Generic name: praziquantel [ PRAZ-i-KWON-tel 1 Brand name: Biltricide
Dosage form: oral tablet (600 mg)
Drug class: Anthelmintics
d by Drugs.com on Feb 1, 2022. Written by Cerner Multum.
Before taking | Side effects ^ Interactions | Dosage
Praziquantel is used to treat infections caused by schistosoma worms, which enter the body through skin that has come into contact with contaminated water. Schistosoma worms are found in Africa, South
175
Biological effect
Anti-toxoplasmic activity Anti-toxoplasmic activity Anti-toxoplasmic activity
Anti-toxoplasmic activity Anti-toxoplasmic activity Anti-malarial effect
(Compound CP1-04-61) Anti-cancer and anti-malarial activity and growth inhibition of wheat-rootlet activities Anti-bacterial activity
Anti-fungal (Candida Albicans) Anti-fungal (Alternaria alternata and Saccharomyces cerevisiae) Anti-malarial, Anti-lcishmanial, Anti-trypanosomal and hypocholesterolemic effect Hypoglycemic, antiplasmodial
and antitrypanosomal effect Anti-toxoplasmic activity
Anti-toxoplasmic activity Anti-toxoplasmic activit:
DM
Nitazoxanide 500mg 18 fim coated toblets
Intestinal Antiprotozoal
References
Benoit-Vical F et al ^! Choi KM et al ^"
Choi KM ег al 27 and Youn HJ '*!
Youn HJ **!
Kavitha М et al ^?!
Mudi SY and Bukar A '*!
Gouda ҮС et al ' and Sathiyamoorthy P et al 22!
Refahy LAG 52
Mandeel Q and Taha A /4!
Mothana RA et al 2!
Alkuwari AD et al ^! Al-Zanbagi NA 1749!
Al-Zanbagi NA 199201 Al-Zanbagi_ NA 221!
Fluke1 Fluke2
Nitazoxanide 100mg/5ml
Powder for oral suspension
LE
THE rt YOU DESERVE
NITAZOXANIDE
In the following link is a list of "anti-viral" agents which are approved or under evaluation for the treatment of Covid. The third drug listed is Nitazoxanide. >https://www.covid19treatmentguidelines.nih.gov/tables/table-2e/
Upon further digging it turns out that NITAZOXANIDE is a dewormer and anti-parasitical. >https://www.medchemexpress.com/nitazoxanide.html >https://www.sciencedirect.com/science/article/abs/pii/S0014489416301746
It is an effective treatment for Cancer. »https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6382696/
Also, since it treats Cancer effectively, it must treat fungal infections...which it does. >https://link.springer.com/article/10.1007/s13258-020-00958-0
Again we see the link between anti-virals also being anti-parasiticals and anti-fungals. We see yet again that these drugs which treat parasites, yeast and viruses also cure the incurable diseases. It was also originally used to get rid of tapeworms.
>https://en.wikipedia.org/wiki/Nitazoxanide
Which begs the question, what is going on in the body with these drugs that they broad-spectrum kill para- sites, yeasts, viruses, harmful microbes and so on? HCQ does this, Fenbendazole does this as well, as does a myriad of herbs like wormwood, neem, epazote, soursop, cloves, walnut leaves and so on. Is there some function in the body we are not yet aware of that these herbs and drugs support? And why does the media seek so desperately to hide all of this information from us?
S pax 4 i "| § paxo p
-— a ne —
жене
History [edit]
Nitazoxanide was originally discovered in the 1980s by Jean-Francois Rossignol at the Pasteur Institute. Initial studies demonstrated activity versus tapeworms. [n vitro studies demonstrated much broader activity. Dr. Rossignol co-founded Romark Laboratories, with the goal of bringing nitazoxanide to market as an anti-parasitic drug. Initial studies in the USA were conducted in collaboration with Unimed Pharmaceuticals, Inc. (Marietta, GA) and focused on development of the drug for treatment of cryptosporidiosis in AIDS. Controlled trials began shortly after the advent of effective anti-retroviral therapies. The trials were abandoned due to poor enrollment and the FDA rejected an application based on
uncontrolled studies.
Subsequently, Romark launched a series of controlled trials. A placebo-controlled study of nitazoxanide in cryptosporidiosis demonstrated significant clinical improvement in adults and children with mild illness. Among malnourished children in Zambia with chronic cryptosporidiosis, a three-day course of therapy led to clinical and parasitologic improvement and improved survival. In Zambia and in a study conducted in Mexico, nitazoxanide was not successful in the treatment of cryptosporidiosis in advanced infection with human immunodeficiency virus at the doses used. However, it was effective in patients with higher CD4 counts. In treatment of giardiasis, nitazoxanide was superior to placebo and
comparable to metronidazole. Nitazoxanide was successful in the treatment of metronidazole-resistant giardiasis. Studies have suggested efficacy in the treatment of cyclosporiasis,
176
BIOFILM
planktonic stage aggregation recruitment and growth mature biofilm & ncbi.nlm.nih.gov/pmc/articles/PMC3585461 /*ref1
Most bacteria form biofilms, which are multicellular microbial communities embedded in a self- produced exopolymeric substance (EPS) largely composed of a protein anchor and different extracellular polymers. Bacteria within a mature biofilm community exist in an altered metabolic state and different physical environment than their free-floating, or planktonic, relatives. Biofilm bacteria generally tolerate antibiotic treatment 2 and antibiotics can induce biofilm formation.
But killing the tapeworm larvae still might not end your tapeworm disease! A few varieties of tapeworms, like Echinococcus multiocularis, have larvae inside their larvae! An even those second generation larvae can have more larvae inside them. These internal larvae are shielded from all things that might harm them.
@ pubmed.ncbi.nlm.nih.gov/25594287/
Prevention of microbial communities: novel
George D Mogosanu, Alexandru M Grumezescu, Keng-Shiang Huang, Ludovic E Bejenaru Cornelia Bejenaru *
Affiliations + expand
PMID: 25594287 DOI: 10.2174/138920101602150112145916
8 nsfgov/discoveries/disc summ jsp?cntn id-3001138&0rg -NSF&from-news
Parasitic worms have armies, produce more soldiers when needed
Abstract
Firmly attached to different living or non-living, solid or fluid surfaces rich in nutrients and moisture, microbial biofilm is a matter of great interest due to its major importance for the healthcare community. Depending on common strategies such as mutual protection and hibernation (quiescent bacteria), the resistance, survival and virulence of microbial communities have large implications for human pathology, clinical environment and biomedical devices. The microbial biofilm is continuously changing, stimulating inflammation, increasing vascular permeability and preventing the action of macrophages. About 8096 of human infections affecting the gastrointestinal, genitourinary and respiratory systems, oral mucosa and teeth, eyes, middle ear and skin are caused by biofilm- associated microorganisms. Therefore, the search for modern strategies is even more important as microbial biofilms resistant to conventional antibiotics, antiseptics and disinfectants are involved in the frequent treatment failures of some chronic inflammatory diseases and wounds. Natural products containing secondary metabolites, such as aromatic compounds, sulphurated derivatives, terpenoids (essential oils) and alkaloids as quorum-sensing inhibitors and biofilm disruptors, are promising alternatives for the prophylaxis and treatment of chronic infections. Surface modification of medical devices with non-polar functionalized nanoparticles stabilizes the natural compounds antibiofilm activity and inhibits microbial adhesion and biofilm formation and growth for a longer period of time. In this regard, an interdisciplinary approach is needed due to the large number of natural derivatives alone or in combination with biocompatible and biodegradable micro-/ nano-engineered materials.
Biofilm is like a fortress for parasites. Adding layer upon layer, parasites create a growing colony inside of your body similar to how an ancient city built a protective wall around it, only to later expand beyond the wall and then build another protective wall around the new section of the city, only to then expand beyond that, and etc. To capture the city, the attackers (white blood cells and deworming meds) must take each wall down, one-by-one. Even if all free roaming parasites are irradicated by deworming treatments, if any section of the biofilm remains, then the parasitic infection will also remain.
177
BIOFILM TREATMENTS
DiatomaceousEarth DE10, 100% Organic Food Grade Diamateous Earth Powder - Safe For Children & Pets 10 LBS
жебе: ~ 20,401
$19.99 & FREE Shipping
Diatomaceous earth is probably the best natural anti-parasitic medication. It is a natural pesticide that does not harm humans or pets. It is believed to kill insects, worms, and parasites by dehydrating them. When used on ants, it usually takes approximately 20 minutes before they are all dead. One tablespoon of diatomaceous earth taken by an adult, once a day for a week, is believed to be extremely effective for killing all parasites. When it is used on children, bear in mind that height is a better indicator of the size of their gastrointestinal tracts than their weights. Thus, a child who is 4 feet tall should take 2 teaspoons, and a child who is 2 feet tall should take 1 teaspoon.
Our research indicates that diatomaceous earth is the best overall parasite treatment for humans, because it can kill blood-borne parasites as well. When using it, be sure to drink plenty of fluids, because it will dehydrate a person considerably. If you take the diatomaceous earth route, then we advise you to only buy it food grade. Industrial diatomaceous earth is used for swimming pool filters, and it has been chemically treated, so this type is not safe to eat. Try to avoid rubbing it onto your hands, since it will have a drying effect upon the skin. Mix the powder into a drink before consuming, in order to avoid inhaling any of the dust.
Diatomaceous earth contains heavy metals as part of its mineral content, but it also contains selenium, which allows otherwise accumulative heavy metals to be safely flushed from the body. Therefore, it is not really a health concern, despite the trace presence of aluminum and lead. We recommend taking selenium supplements for a week after discontinuing this treatment to ensure that the body thoroughly neutralizes the metals. Concerned individuals can follow the parasite cleanse with a metal cleanse.
Bragg Organic Apple Cider Vinegar With the Mother- USDA Certified Organic - Raw, Unfiltered All Natural Ingredients, 16 ounce ЖЖЖ ~ 51
$12.99 & FREE Shipping on orders over $25.00 s... 12 Used & New from $12.49
= ж
Liver Flush:
178
SILVER
ncbi.nim.nih.gov/pmc/articles/PMC68 158
Nanosilver Colloid Inhibits Toxoplasma gondii Tachyzoites and Bradyzoites in Vitro
Saeedeh SHOJAEE, !” Nima FIROUZEH,' Hussein KESHAVARZ 122 Sanaz JAFAR-POUR AZAMI, Mahboobeh SALIMI,’ and Mehdi MOHEBALI'?
* Author information > Article notes » Copyright and License information Disclaimer Abstract Background:
Toxoplasma gondii, the coccidian protozoan parasite with worldwide distribution, is the agent of toxoplasmosis. The disease is life threatening in congenital form and in immunocompromised patients. The present study was carried out in 2016 to evaluate the in vitro effects of nanosilver colloid on tachyzoites and bradyzoites of T. gondii, RH and Tehran strains.
Methods:
Different concentrations (5, 10, 20 ppm) of nanosilver colloid were added to tachyzoites of T. gondii, RH strain (type I) and bradyzoites and tissue cysts of T. gondii, Tehran strain (type II) and incubated for 30, 60, 90 and 120 minutes. The mortality rates of tachyzoites and bradyzoites were evaluated by trypan blue dye and MTT assay. Then SEM carried out to show the changes between control and exposed parasites.
Results:
The greatest mortality rate was seen in 20 ppm concentration and after 120 minutes of exposure. By electron microscopy, the structural changes were seen in tachyzoites of RH and tissue cyst of Tehran strain in comparison with control groups.
Conclusion:
Nanosilver colloid was effective on both tachyzoites and bradyzoites of T. gondii, RH and Tehran strains.
TRIQUETRA®
COLEOIDAL
SILVER
Effective against internal parasites. Effective against external parasites.
179
The virgin de-woomer THE CHAD VERME CTIN HONKLER
Eating for six gorillion, still skinny No thoughts or creativity.
Takes every thing at face value HAS FULLY SEEN THE SERPENT
smiles while reading parasite threads
A colony lives in him Can't cope with wormworld
Defeatist No honks Effortlessly btfos entire WIDF Squads worm world has to live with him Never Jabbed worried about gay anal worms Pure Blood Vaxxed Parasite Free Smells like apples and tobacco PP Sneed and Feed is a mindless drone to the hive refused ascension to shit post in the material realm with the boys
180